Degradation of BCR-ABL fusion protein in chronic myeloid leukemia cells induced by isoalantolactone

doi:10.3969/j.issn.1674-8115.2021.07.007

Abstract

Abstract: Objective

·To explore the effect of isoalantolactone (Iso) on imatinib-sensitive and drug-resistant chronic myeloid leukemia (CML) cells, and the molecular mechanism of down regulating BCR-ABL fusion protein.

Methods

·K562 and K562R cells were treated with different concentrations of Iso for 0, 24, 36 and 48 h, respectively. The inhibitory effect of Iso on CML cells was determined by CCK-8 method. The apoptosis of K562 and K562R cells induced by Iso for 24 h was detected by flow cytometry. CML cells were treated with different concentration of Iso for different time, and the effect of Iso on the level of BCR-ABL fusion protein was detected by Western blotting. The effect of Iso on BCR-ABL mRNA level in CML cells was detected by reverse transcription and quantitative real-time PCR (qPCR). K562 cells were treated with proteasome inhibitor MG132, autophagy inhibitor 3-methyladenine and lysosomal inhibitor chloroquine combined with Iso, respectively, and K562 and K562R cells were treated with caspase inhibitor Z-VAD-FMK combined with Iso. The level of BCR-ABL fusion protein was detected by Western blotting. Caspase 3 (CASP3) and caspase 7 (CASP7) were knocked down in K562R cells, and their effects on the down-regulation of BCR-ABL fusion protein induced by Iso were detected.

Results

·The proliferation of CML cells was inhibited by Iso in a dose- and time-dependent manner. Flow cytometry showed that Iso could increase the apoptosis of K562 and K562R cells (both P<0.05). Western blotting showed that Iso could induce the decrease of BCR-ABL fusion protein level, while qPCR showed that BCR-ABL mRNA level had no significant change. MG132, 3-methyladenine and chloroquine could not reverse the down-regulation of BCR-ABL fusion protein induced by Iso, but Z-VAD-FMK could partially reverse the down-regulation. Knockdown of CASP3 could partially reverse the degradation of BCR-ABL protein induced by Iso, while CASP7 could not.

Conclusion

·Iso can target the degradation of BCR-ABL fusion protein, which provides an experimental basis for overcoming drug resistance of CML cells.

Key words: isoalantolactone (Iso), BCR-ABL fusion protein, chronic myeloid leukemia (CML), protein degradation, caspase 3 (CASP3)

CLC Number:

R733.72

Chen CHEN, Feng-hou GAO. Degradation of BCR-ABL fusion protein in chronic myeloid leukemia cells induced by isoalantolactone[J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 891-897.

Figures/Tables 9

Tab 1 Primer sequence for qPCR

Gene	Forward primer （5′→3′）	Reverse primer （5′→3′）
β-actin	TCGTGCGTGACATTAAGGAG	GTCAGGCAGCTCGTAGCTCT
BCR-ABL	CGGGAGCAGCAGAAGAAGTGT	CGAAAAGGTTGGGGTCATTTTC

Tab 2 Target sequence of knockdown

Name	Target gene	Target sequence （5′→3′）
shCASP7-1	CASP7	GGCAAATGCATCATAATAA
shCASP7-2	CASP7	GCCCATCAATGACACAGAT
shCASP3-1	CASP3	CCCTGGACAACAGTTATAA
shCASP3-2	CASP3	GCGTGATGTTTCTAAAGAA
NC	Limulus polyphemus $δ$ -like protein B	GTTCTCCGAACGTGCACGT

Tab 2 Target sequence of knockdown

Name	Target gene	Target sequence （5′→3′）
shCASP7-1	CASP7	GGCAAATGCATCATAATAA
shCASP7-2	CASP7	GCCCATCAATGACACAGAT
shCASP3-1	CASP3	CCCTGGACAACAGTTATAA
shCASP3-2	CASP3	GCGTGATGTTTCTAAAGAA
NC	Limulus polyphemus $δ$ -like protein B	GTTCTCCGAACGTGCACGT

Tab 3 Analysis of proliferation inhibition rate of K562/K562R cells by Iso （%）

Group	Phase of treatment with Iso in K562 cells			Phase of treatment with Iso in K562R cells
Group	24 h	36 h	48 h	24 h	36 h	48 h
Control group （0 μmol·L^-1 Iso）	0	0	0	0	0	0
Iso treatment group
2.5 μmol·L^-1	2.9±0.8	5.1±2.7	1.9±1.0	0.1±1.0	0.7±1.4	6.2±3.1
5 μmol·L^-1	11.7±1.8	33.5±0.9^①	44.7±3.5^①	1.9±4.1	4.6±1.2	15.2±0.7^①
10 μmol·L^-1	34.1±1.7^①	54.4±0.7^①	68.9±0.5^①	15.5±1.0^①	23.9±2.0^①	33.6±0.9^①
20 μmol·L^-1	41.7±0.7^①	60.6±1.0^①	73.4±0.5^①	23.7±0.7^①	31.6±1.7^①	55.5±0.6^①
40 μmol·L^-1	52.4±1.0^①	66.6±1.1^①	77.9±0.4^①	30.9±0.7^①	45.2±1.4^①	63.5±1.3^①
80 μmol·L^-1	53.3±0.8^①	70.8±0.6^①	82.7±0.4^①	38.2±0.8^①	48.7±0.2^①	67.9±1.5^①

Fig 1 Apoptosis inducing effects of Iso on K562 and K562R cells by flow cytometry

Fig 2 Effects of Iso on the levels of apoptosis-related protein and BCR-ABL fusion protein in K562 and K562R cells at different concentrations and time

Fig 3 Effects of Iso on the level of BCR-ABL mRNA in K562 cells (A) and K562R cells (B)

Fig 4 Effects of proteasome inhibitor MG132 (A), autophagy inhibitor 3-MA (B) and lysosomal inhibitor CQ (C) on the down-regulation of BCR-ABL fusion protein induced by Iso

Fig 5 Effects of caspase inhibition Z-VAD-FMK on the down-regulation of BCR-ABL fusion protein induced by Iso

Fig 6 Effects of CASP7 (A) and CASP3 (B) knockdown on the down-regulation of BCR-ABL fusion protein induced by Iso

TrendMD

References 19

1	Apperley JF. Chronic myeloid leukaemia[J]. Lancet, 2015, 385(9976): 1447-1459.
2	Chereda B, Melo JV. Natural course and biology of CML[J]. Ann Hematol, 2015, 94(): S107-S121.
3	Quintás-Cardama A, Cortes J. Molecular biology of bcr-abl1-positive chronic myeloid leukemia[J]. Blood, 2009, 113(8): 1619-1630.
4	Jabbour E, Kantarjian H. Chronic myeloid leukemia: 2018 update on diagnosis, therapy and monitoring[J]. Am J Hematol, 2018, 93(3): 442-459.
5	Waller CF. Imatinib mesylate[J]. Recent Results Cancer Res, 2018, 212: 1-27.
6	Soverini S, Mancini M, Bavaro L, et al. Chronic myeloid leukemia: the paradigm of targeting oncogenic tyrosine kinase signaling and counteracting resistance for successful cancer therapy[J]. Mol Cancer, 2018, 17(1): 49.
7	Singh VK, Coumar MS. Chronic myeloid leukemia: existing therapeutic options and strategies to overcome drug resistance[J]. Mini Rev Med Chem, 2019, 19(4): 333-345.
8	Wang Q, Gao S, Wu GZ, et al. Total sesquiterpene lactones isolated from Inula helenium L. attenuates 2, 4-dinitrochlorobenzene-induced atopic dermatitis-like skin lesions in mice[J]. Phytomedicine, 2018, 46: 78-84.
9	Li ZL, Qin BY, Qi XG, et al. Isoalantolactone induces apoptosis in human breast cancer cells via ROS-mediated mitochondrial pathway and downregulation of SIRT1[J]. Arch Pharm Res, 2016, 39(10): 1441-1453.
10	Huang R, Kang Q, Liu HM, et al. New insights into the molecular resistance mechanisms of chronic myeloid leukemia[J]. Curr Cancer Drug Targets, 2016, 16(4): 323-345.
11	Yin B, Fang DM, Zhou XL, et al. Natural products as important tyrosine kinase inhibitors[J]. Eur J Med Chem, 2019, 182: 111664.
12	Shi XP, Chen X, Li XF, et al. Gambogic acid induces apoptosis in imatinib-resistant chronic myeloid leukemia cells via inducing proteasome inhibition and caspase-dependent Bcr-Abl downregulation[J]. Clin Cancer Res, 2014, 20(1): 151-163.
13	Lu XX, Geng JJ, Zhang JM, et al. Xanthohumol, a prenylated flavonoid from hops, induces caspase-dependent degradation of oncoprotein BCR-ABL in K562 cells[J]. Antioxidants (Basel), 2019, 8(9): E402.
14	Lan XY, Zhao C, Chen X, et al. Platinum pyrithione induces apoptosis in chronic myeloid leukemia cells resistant to imatinib via DUB inhibition-dependent caspase activation and Bcr-Abl downregulation[J]. Cell Death Dis, 2017, 8(7): e2913.
15	Van Opdenbosch N, Lamkanfi M. Caspases in cell death, inflammation, and disease[J]. Immunity, 2019, 50(6): 1352-1364.
16	D′Arcy MS. Cell death: a review of the major forms of apoptosis, necrosis and autophagy[J]. Cell Biol Int, 2019, 43(6): 582-592.
17	Veluthakal R, Arora DK, Goalstone ML, et al. Metabolic stress induces caspase-3 mediated degradation and inactivation of farnesyl and geranylgeranyl transferase activities in pancreatic β-cells[J]. Cell Physiol Biochem, 2016, 39(6): 2110-2120.
18	Ethell DW, Bossy-Wetzel E, Bredesen DE. Caspase 7 can cleave tumor necrosis factor receptor-I (p60) at a non-consensus motif, in vitro[J]. Biochim Biophys Acta, 2001, 1541(3): 231-238.
19	di Bacco AM, Cotter TG. p53 expression in K562 cells is associated with caspase-mediated cleavage of c-ABL and BCR-ABL protein kinases[J]. Br J Haematol, 2002, 117(3): 588-597.