Effect of miR-124-1 mediated by exosomes of bone marrow-derived mesenchymal stem cells on the regulation of transformation of M2 microglia

doi:10.3969/j.issn.1674-8115.2022.03.009

Abstract

Abstract: Objective

·To investigate the effect of exosomes (Exo) of bone marrow-derived mesenchymal stem cells (BMMSCs) overexpressing miR-124-1 gene on the regulation of transformation of M2 microglia (MG).

Methods

·BMMSCs of rats were isolated and cultured. BMMSCs-Exo were extracted. BMMSCs and BMMSCs-Exo were identified by flow cytometry, transmission electron microscope (TEM) and Western blotting, respectively. MiR-124-1 gene was synthesized and its lentiviral vector was constructed. The expression changes of miR-124-1 gene in BMMSCs and BMMSCs-Exo were observed. BMMSCs-Exo overexpressing miR-124-1 gene (Exo/124-1) was co-cultured with HAPI microglia cell line activated by lipopolysaccharide (LPS). Cells from Exo group and EXO/124-1 group were collected, respectively. HAPI cells cultured with LPS only (LPS group) were compared with untreated HAPI cells (normal group). Quantitative real-time PCR (qPCR) and Western blotting were used to detect the mRNA and protein expression of M1 molecules [interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α)] and M2 molecules(CD206, IL-10) in HAPI cells.

Results

·BMMSCs and BMMSCs-Exo were successfully isolated, cultured and identified. Exo/124-1 significantly expressed miR-124-1 gene. BMMSCs-Exo could carry miR-124-1 gene, significantly down-regulating the expression of IL-6 (compared with the normal group and the LPS group, the down-regulation percentage were 55.71% and 73.04%, respectively at the gene level, and the percentages were 52.32% and 76.95%, respectively at the protein level) and TNF-α (compared with the normal group and the LPS group, the down-regulation percentage were 51.95% and 68.91%, respectively at the gene level, and 52.14% and 77.47%, respectively at the protein level) of HAPI cells tested by qPCR and Western blotting. Exo/124-1 up-regulated the expression of CD206 (compared with the normal group and the LPS group, the down-regulation percentage were 46.90% and 76.99%, respectively at the gene level, and 65.13% and 85.11%, respectively at the protein level) and IL-10 (compared with the normal group and the LPS group, the down-regulation percentage were 43.09% and 72.36%, respectively at the gene level, and 55.19% and 78.18%, respectively at the protein level) in HAPI cells.

Conclusion

·BMMSCs-Exo can mediate miR-124-1 to regulate the polarization of HAPI cells to M2 type.

Key words: bone marrow-derived mesenchymal stem cell (BMMSC), exosome (Exo), miR-124-1 gene, HAPI cell, the polarization of M2 type

CLC Number:

R392.2

HAO Lei, JIN Ge, YANG Yongtao, WANG Junwei, SUN Yang, QIN Cuiling, ZHAN Qunling. Effect of miR-124-1 mediated by exosomes of bone marrow-derived mesenchymal stem cells on the regulation of transformation of M2 microglia[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 323-330.

Figures/Tables 9

Tab 1 Primer sequences for qPCR

Gene	Forward primer （5'→3'）	Reverse primer （5'→3'）
TNF-α	ACCAGCAGATGGGCTGTACC	GCGGAGAGGAGGCTGACTTT
IL-6	CCACTGCCTTCCCTACTTCA	ACAGTGCATCATCGCTGTTC
IL-10	CGACGCTGTCATCGATTTCT	TAGATGCCGGGTGGTTCAAT
CD206	TGGGCTTATGGAGAGCCAAA	TCTGCAGTCACTGGTGGATT
Gapdh	TCAAGAAGGTGGTGAAGCAG	AGGTGGAAGAATGGGAGTTG

Fig 1 BMMSCs subcultured and expanded under microscope

Fig 2 Detection of the positive rates of CD44 (A), CD90 (B) and CD45 (C) in BMMSCs by flow cytometry

Fig 3 Identification of BMMSCs-Exo

Fig 4 Sequencing and identification of recombinant lentiviral vector FT106/miR-124-1

Fig 5 Recombinant lentiviral vector FT106/miR-124-1 packaged with 293T cells

Fig 6 Recombinant lentivirus infection rate in BMMSCs and BMMSCs-Exo

Fig 7 Effects of overexpressing miR-124-1 gene in BMMSCs-Exo on the expressions of CD206, IL-10, IL-6 and TNF-α mRNA of HAPI cells detected by qPCR

Fig 8 Effects of overexpressing miR-124-1 gene in BMMSCs-Exo on the expressions of CD206, IL-10, IL-6 and TNF-α protein in HAPI cells detected by Western blotting

TrendMD

References 26

1	郝磊, 田洪, 牟长河, 等. 沉默CX3CL1基因对骨髓间充质干细胞生长及其趋化效应的影响[J]. 第三军医大学学报, 2017, 39(1): 34-41.
2	CHEN Y, WON S J, XU Y, et al. Targeting microglial activation in stroke therapy: pharmacological tools and gender effects[J]. Curr Med Chem, 2014, 21(19): 2146-2155.
3	MA Y Y, WANG J X, WANG Y T, et al. The biphasic function of microglia in ischemic stroke[J]. Prog Neurobiol, 2017, 157: 247-272.
4	KANAZAWA M, NINOMIYA I, HATAKEYAMA M, et al. Microglia and monocytes/macrophages polarization reveal novel therapeutic mechanism against stroke[J]. Int J Mol Sci, 2017, 18(10): 2135.
5	CHUNG J W, CHANG W H, BANG O Y, et al. Efficacy and safety of intravenous mesenchymal stem cells for ischemic stroke[J]. Neurology, 2021, 96(7): e1012-e1023.
6	Kruger M J, Conradie Ｒ, Conradie M, et al. ADSC-conditioned media elicit an ex vivo anti-inflammatory macrophage response[J]. J Mol Endocrinol, 2018, 61(4): 173-184.
7	HU Y, RAO S S, WANG Z X, et al. Exosomes from human umbilical cord blood accelerate cutaneous wound healing through miR-21-3p-mediated promotion of angiogenesis and fibroblast function[J]. Theranostics, 2018, 8(1): 169-184.
8	WANG Y, ZHANG L, LI Y, et al. Exosomes/microvesicles from induced pluripotent stem cells deliver cardioprotective miRNAs and prevent cardiomyocyte apoptosis in theischemic myocardium[J]. Int J Cardiol, 2015, 192: 61-69.
9	NAKAO Y, FUKUDA T, ZHANG Q Z, et al. Exosomes from TNF-α-treated human gingiva-derived MSCs enhance M2 macrophage polarization and inhibit periodontal bone loss[J]. Acta Biomater, 2021, 122: 306-324.
10	VARGAS J, SPIOTTA A, FARGEN K, et al. Long term experience using the ADAPT technique for the treatment of acute ischemic stroke[J]. J Neurointerventional Surg, 2017, 9(5): 437-441.
11	LI D B, LIU J L, WANG W, et al. Plasma exosomal miR-422a and miR-125b-2-3p serve as biomarkers for ischemic stroke[J]. Curr Neurovascular Res, 2017, 14(4): 330-337.
12	XIN H Q, KATAKOWSKI M, WANG F J, et al. MiR-17-92 cluster in exosomes enhance neuroplasticity and functional recovery after stroke in rats[J]. Stroke, 2017, 48(3): 747-753.
13	TANG J Z, LIN X, ZHONG J Y, et al. MiR‑124 regulates the osteogenic differentiation of bone marrow‑derived mesenchymal stem cells by targeting Sp7[J]. Mol Med Rep, 2019, 19(5): 3807-3814.
14	LU Z B, LIU S H, OU J Y, et al. Forsythoside A inhibits adhesion and migration of monocytes to type Ⅱ alveolar epithelial cells in lipopolysaccharide-induced acute lung injury through upregulating miR-124[J]. Toxicol Appl Pharmacol, 2020, 407: 115252.
15	PERIYASAMY P, LIAO K, KOOK Y H, et al. Cocaine-mediated downregulation of miR-124 activates microglia by targeting KLF₄ and TLR4 signaling[J]. Mol Neurobiol, 2018, 55(4): 3196-3210.
16	LAN X, HAN X N, LI Q, et al. Modulators of microglial activation and polarization after intracerebral haemorrhage[J]. Nat Rev Neurol, 2017, 13(7): 420-433.
17	XIONG X Y, LIU L, YANG Q W. Functions and mechanisms of microglia/macrophages in neuroinflammation and neurogenesis after stroke[J]. Prog Neurobiol, 2016. 142: 23-44.
18	WEN Z, MAI Z, ZHU X, et al. Mesenchymal stem cell-derived exosomes ameliorate cardiomyocyte apoptosis in hypoxic conditions through microRNA144 by targeting the PTEN/AKT pathway[J]. Stem Cell Res Ther, 2020, 11(1): 36.
19	LI Y X, SHEN Z Y, YU X Y. Transport of microRNAs via exosomes[J]. Nat Rev Cardiol, 2015, 12(4): 198.
20	BÖRGER V, BREMER M, FERRER-TUR R, et al. Mesenchymal stem/stromal cell-derived extracellular vesicles and their potential as novel immunomodulatory therapeutic agents[J]. Int J Mol Sci, 2017, 18(7): 1450.
21	ARMSTRONG J P K, STEVENS M M. Strategic design of extracellular vesicle drug delivery systems[J]. Adv Drug Deliv Rev, 2018, 130: 12-16.
22	ZHAO H, SHANG Q W, PAN Z Z, et al. Exosomes from adipose-derived stem cells attenuate adipose inflammation and obesity through polarizing M2 macrophages and beiging in white adipose tissue[J]. Diabetes, 2018, 67(2): 235-247.
23	SHEKHAR S, CUNNINGHAM M W, PABBIDI M R, et al. Targeting vascular inflammation in ischemic stroke: recent developments on novel immunomodulatory approaches[J]. Eur J Pharmacol, 2018, 833: 531-544.
24	XU J Y, ZHENG Y Y, WANG L J, et al. MiR-124: a promising therapeutic target for central nervous system injuries and diseases[J]. Cell Mol Neurobiol, 2021: 1-23.
25	DABROWSKA S, ANDRZEJEWSKA A, LUKOMSKA B, et al. Neuroinflammation as a target for treatment of stroke using mesenchymal stem cells and extracellular vesicles[J]. J Neuroinflammation, 2019, 16(1): 178.
26	HAMZEI TAJ S, KHO W, ASWENDT M, et al. Dynamic modulation of microglia/macrophage polarization by miR-124 after focal cerebral ischemia[J]. J Neuroimmune Pharmacol, 2016, 11(4): 733-748.