Comparison of mitochondria and NAD+ level in the murine cochleae of C57BL/6J mice at different ages

doi:10.3969/j.issn.1674-8115.2022.08.002

Abstract

Abstract:

Objective ·To investigate the changes of mitochondria and nicotinamide adenine dinucleotide (NAD⁺) levels in the cochleae of C57BL/6J mice at different ages, and explore potential mechanism of age-related hearing loss. Methods ·Forty C57BL/6J male mice aged 1, 4, 8, 12 months, respectively, were chosen and classified into 4 groups in terms of age (n=10). Auditory brain response (ABR) and distortion product otoacoustic emission (DPOAE) were conducted to detect the auditory function of mice at different ages; real-time quantitative PCR (RT-qPCR) was applied to compare the mRNA expression levels of the genes associated with mitochondrial energy metabolism in the cochleae of mice at different ages, including Ndufb5 (NADH: ubiquinone oxidoreductase subunit B5), Sdha (succinate dehydrogenase complex flavoprotein subunit A), Sdhc (succinate dehydrogenase complex subunit C), and Atp5b (ATP synthase, H⁺ transporting mitochondrial F1 complex, beta subunit); the changes of mitochondrial quantity in the cochlear hair cells from the mice aged 1 month and 12 months were observed by whole-mount immunofluorescence; the mitochondrial ultrastructure in the cochlear sensory epithelia including outer and inner hair cells, myelinate nerve fibers and spiral ganglion neurons of 1- and 12-month-old mice was observed by transmission electron microscope (TEM); NAD⁺ levels in the cochleae of mice at different ages were detected by quantitative colorimetry. Results ·The ABR thresholds of the 12-month-old mice were significantly elevated in comparison with those of the 1-month-old mice at the frequency range of 5.66?45.00 kHz (P<0.01); and the DPOAE thresholds of the 12-month-old mice were significantly elevated in comparison with those of the 1-month-old mice at the frequency range of 11.32?32.00 kHz (P<0.01). The expression levels of the genes related to mitochondrial functions including Ndufb5, Sdha, Sdhc, and Atp5b showed a downward trend with the age, which in the 8-month-old and 12-month-old mice were significantly different from those in the 1-month-old mice (P<0.05). Immunostaining showed that the number of mitochondria in cochlear inner hair cells of the 12-month-old mice was significantly lower than that of 1-month-old mice. It was observed by TEM that vacuolar degenerated mitochondria and larger lipofuscin existed in the inner hair cells, myelinate nerve fibers and spiral ganglion neurons of the 12-month-old mice. The NAD⁺ level showed a decreasing trend with age, declining significantly from 8 months of age, compared with the 1-month-old mice (P<0.01). Conclusion ·Mitochondrial dysfunction with abnormal structure and descending NAD⁺ levels in the cochleae is consistent with hearing function deterioration in C57BL/6J aging mice.

Key words: aged-related hearing loss, hearing loss, mitochondria, aging, nicotinamide adenine dinucleotide (NAD⁺)

CLC Number:

R764.3

FENG Baoyi, DONG Tingting, ZHENG Xiaofei, TAO Yong, WU Hao. Comparison of mitochondria and NAD⁺ level in the murine cochleae of C57BL/6J mice at different ages[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 980-986.

Figures/Tables 5

Tab 1 Primer sequences for real-time qPCR

Name	Sequence（5'→3'）
Ndufb5-Forward	CTTCGAACTTCCTGCTCCTT
Ndufb5-Reverse	GGCCCTGAAAAGAACTACG
Sdha-Forward	GGAACACTCCAAAAACAGACCT
Sdha-Reverse	CCACCACTGGGTATTGAGTAGAA
Sdhc-Forward	GCTGCGTTCTTGCTGAGACA
Sdhc-Reverse	ATCTCCTCCTTAGCTGTGGTT
Atp5b-Forward	GGTTCATCCTGCCAGAGACTA
Atp5b-Reverse	AATCCCTCATCGAACTGGACG
Rpl19-Forward	ACCTGGATGAGAAGGATGAG
Rpl19-Reverse	ACCTTCAGGTACAGGCTGTG

Fig 1 Comparison of auditory function in C57BL/6J mice at different ages (n=5)

Fig 2 Comparison of expression levels of mitochondrial function-related genes and proteins in the cochleae of C57BL/6J mice at different ages

Fig 3 Comparison of mitochondrial ultrastructure in different cells in the cochleae of mice aged 1 month and 12 months

Fig 4 Comparison of NAD+ levels in the cochleae of mice at different ages

TrendMD

References 24

1	CHADHA S, KAMENOV K, CIEZA A. The world report on hearing, 2021[J]. Bull World Health Organ, 2021, 99(4): 242-242A.
2	JAFARI Z, KOLB B E, MOHAJERANI M H. Age-related hearing loss and tinnitus, dementia risk, and auditory amplification outcomes[J]. Ageing Res Rev, 2019, 56: 100963.
3	KEITHLEY E M. Pathology and mechanisms of cochlear aging[J]. J Neurosci Res, 2020, 98(9): 1674-1684.
4	FUJIMOTO C, YAMASOBA T. Mitochondria-targeted antioxidants for treatment of hearing loss: a systematic review[J]. Antioxidants (Basel), 2019, 8(4): 109.
5	COVARRUBIAS A J, PERRONE R, GROZIO A, et al. NAD⁺ metabolism and its roles in cellular processes during ageing[J]. Nat Rev Mol Cell Biol, 2021, 22(2): 119-141.
6	WU P Z, O'MALLEY J T, DE GRUTTOLA V, et al. Age-related hearing loss is dominated by damage to inner ear sensory cells, not the cellular battery that powers them[J]. J Neurosci, 2020, 40(33): 6357-6366.
7	LYU A R, KIM T H, PARK S J, et al. Mitochondrial damage and necroptosis in aging cochlea[J]. Int J Mol Sci, 2020, 21(7): 2505.
8	HEQUEMBOURG S, LIBERMAN M C. Spiral ligament pathology: a major aspect of age-related cochlear degeneration in C57BL/6 mice[J]. J Assoc Res Otolaryngol, 2001, 2(2): 118-129.
9	TAN W J T, THORNE P R, VLAJKOVIC S M. Characterisation of cochlear inflammation in mice following acute and chronic noise exposure[J]. Histochem Cell Biol, 2016, 146(2): 219-230.
10	DRÖSE S, BRANDT U. Molecular mechanisms of superoxide production by the mitochondrial respiratory chain[J]. Adv Exp Med Biol, 2012, 748: 145-169.
11	LIN M T, BEAL M F. Mitochondrial dysfunction and oxidative stress in neurodegenerative diseases[J]. Nature, 2006, 443(7113): 787-795.
12	RENTON J P, XU N Y, CLARK J J, et al. Interaction of neurotrophin signaling with Bcl-2 localized to the mitochondria and endoplasmic reticulum on spiral ganglion neuron survival and neurite growth[J]. J Neurosci Res, 2010, 88(10): 2239-2251.
13	WHITE K, KIM M J, HAN C, et al. Loss of IDH2 accelerates age-related hearing loss in male mice[J]. Sci Rep, 2018, 8(1): 5039.
14	SONG X, CHEN Z Z, JIA R Y, et al. Transcriptomics and proteomic studies reveal acaricidal mechanism of octadecanoic acid-3,4 - tetrahydrofuran diester against Sarcoptes scabiei var. cuniculi[J]. Sci Rep, 2017, 7: 45479.
15	GO Y M, SUTLIFF R L, CHANDLER J D, et al. Low-dose cadmium causes metabolic and genetic dysregulation associated with fatty liver disease in mice[J]. Toxicol Sci, 2015, 147(2): 524-534.
16	QUINTANA-CABRERA R, MEHROTRA A, RIGONI G, et al. Who and how in the regulation of mitochondrial cristae shape and function[J]. Biochem Biophys Res Commun, 2018, 500(1): 94-101.
17	LAUTRUP S, SINCLAIR D A, MATTSON M P, et al. NAD⁺ in brain aging and neurodegenerative disorders[J]. Cell Metab, 2019, 30(4): 630-655.
18	FANG E F, KASSAHUN H, CROTEAU D L, et al. NAD⁺ replenishment improves lifespan and healthspan in ataxia telangiectasia models via mitophagy and DNA repair[J]. Cell Metab, 2016, 24(4): 566-581.
19	LIU D, PITTA M, JIANG H Y, et al. Nicotinamide forestalls pathology and cognitive decline in Alzheimer mice: evidence for improved neuronal bioenergetics and autophagy procession[J]. Neurobiol Aging, 2013, 34(6): 1564-1580.
20	LEE C F, CHAVEZ J D, GARCIA-MENENDEZ L, et al. Normalization of NAD⁺ redox balance as a therapy for heart failure[J]. Circulation, 2016, 134(12): 883-894.
21	MUKHERJEE S, CHELLAPPA K, MOFFITT A, et al. Nicotinamide adenine dinucleotide biosynthesis promotes liver regeneration[J]. Hepatology, 2017, 65(2): 616-630.
22	BROWN K D, MAQSOOD S, HUANG J Y, et al. Activation of SIRT3 by the NAD⁺ precursor nicotinamide riboside protects from noise-induced hearing loss[J]. Cell Metab, 2014, 20(6): 1059-1068.
23	KIM H J, OH G S, SHEN A, et al. Augmentation of NAD⁺ by NQO1 attenuates cisplatin-mediated hearing impairment[J]. Cell Death Dis, 2014, 5(6): e1292.
24	KIM H J, CAO W, OH G S, et al. Augmentation of cellular NAD⁺ by NQO1 enzymatic action improves age-related hearing impairment[J]. Aging Cell, 2019, 18(5): e13016.

[1]	LIU Siyu, WU Bing, LI Xiaomin, ZHAO Lulu, CHEN Jun, AI Songtao. Preliminary exploration of diffusion-weighted imaging in pre-surgical planning of dermatofibrosarcoma protuberans [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 1095-1102.
[2]	WANG Yuxin, SUN Ruiqi, LIU Jianhua, HE Weina. Development of pH-responsive fluorescent probe for tumor microenvironment imaging [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 875-884.
[3]	CHEN Liqi, XUE Zhuowei, WU Qingkai. Review of MRI-based three-dimensional digital model reconstruction of female pelvic floor organs [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 381-386.
[4]	LIN Yijia, CHENG Lizhen, MIAO Ya. Research progress in the role and mechanism of abnormal mitophagy in Alzheimer's disease [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 387-392.
[5]	Jialei ZHOU, Haibin SHENG, Haoyu WANG, Yan LU, Fangfang WANG, Hao WU, Yunfeng HUA. Application of three-dimensional electron microscopy to morphological study of neurons in brainstem cochlear nucleus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 142-149.
[6]	Guodong DANG, Xinyu HONG, Meiqin CAI. Interventional effects of nicotinamide mononucleotide on metabolism in aging mice [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 158-165.
[7]	Xuehong WANG, Xuzhuo CHEN, Yi MAO, Da SHEN, Shanyong ZHANG. Difference in recurrence rates after temporomandibular joint disc repositioning surgery with miniscrew anchor at different developmental stages in adolescents [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 173-177.
[8]	Yihuan WANG, Ruokun LI, Huanhuan CHONG, Fuhua YAN. Research progress of Gd-EOB-DTPA-enhanced magnetic resonance imaging in the evaluation of biological behavior of hepatocellular carcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 130-134.
[9]	Cui CHEN, Ye JIN, Lin WANG, Hongli LI, Caifeng WAN, Lixin JIANG. Comparative analysis of 30 cases of metaplastic carcinoma of the breast [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 70-76.
[10]	Yi-yang SHU, Si-qi ZHANG, Hai-yun LIU. Research progress of imaging markers for identifying and predicting the progression of age-related macular degeneration [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(9): 1240-1245.
[11]	Lei XIONG, Qian YI, Ming-fang XU, Jian CHEN. Expression and prognosis analysis of MRPL12 in lung adenocarcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1033-1040.
[12]	Zi-hao LIU, Wen-fang TANG, Hui WANG. Research progress in amino acid PET imaging of pediatric brain tumors [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 949-952.
[13]	Jiang-lei MA, Xiao-yao LI, Shi-fu ZHAO, De-jun YANG. Advances in diagnostic methods of clinical staging for gastric cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 821-825.
[14]	Ya-zhong WEI, Xiao-mei XUE, Bin HE. Research progress in myocardial ischemia-reperfusion injury mediated by mitochondrial reactive oxygen species [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 826-829.
[15]	Ming-qi CAI, Yan CHEN, Kai-bin LIN, Dong HUANG. Advances in the role of growth differentiation factor 11 in cardiovascular diseases [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 834-838.