Effects and mechanisms of KRAS4AG12C and KRAS4BG12C in the proliferation and migration of human pulmonary epithelial cells

doi:10.3969/j.issn.1674-8115.2022.08.006

Abstract

Abstract:

Objective ·To explore how the two splice variants of oncogenic mutant KRAS^G12C, KRAS4A^G12Cand KRAS4B^G12C, promote the proliferation and migration of human pulmonary epithelial bronchial BEAS-2B cells. Methods ·The two splice variants of oncogenic mutant KRAS^G12C, KRAS4A^G12Cand KRAS4B^G12C, were stably overexpressed in human normal pulmonary epithelial bronchial BEAS-2B cells by lentivirus packaging and infection system. Western blotting was used to verify whether the model was constructed successfully. Cell morphology was investigated by inverted phase-contrast microscopy. Cell proliferation was observed by the Incucyte Live Cell Analysis System. Cell migration was characterized by scratch wound assay and transwell assay. To investigate the mechanisms, RNA-sequencing (RNA-seq) was used to provide insight into the transcriptome of the indicated cells, Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Set Enrichment Analysis (GSEA) were performed to identify differential genes and signaling pathways enriched in ranked gene lists, and quantitative real-time PCR (qPCR) was used to further verify different genes. Student's t test (t test) was used for comparison between the two groups. Statistical significance was accepted at a value of P<0.05. Results ·Both overexpression of KRAS4A^G12C and KRAS4B^G12C induced morphological changes, including increased invasive pseudopodia structures and cell junctions of BEAS-2B cells. Compared with BEAS-2B cells, the cell proliferation was significantly enhanced in BEAS-2B KRAS4A^G12C and BEAS-2B KRAS4B^G12C cells. In addition, overexpression of KRAS4B^G12C effectively promoted wound healing of BEAS-2B cells (P=0.000) and BEAS-2B KRAS4A^G12C cells (P=0.006), as scratch wound assay characterized. And overexpression of KRAS4B^G12C effectively promoted cell migration of BEAS-2B cells (P=0.033) and BEAS-2B KRAS4A^G12C cells (P=0.048), as transwell assay characterized. Mechanically, compared with BEAS-2B KRAS4A^G12C cells, cell adhesion molecules gene set was enriched and the mRNA levels of claudin 1 (CLDN1) (P=0.000) and cell adhesion molecule 3 (CADM3) (P=0.000) were up-regulated in BEAS-2B KRAS4B^G12C cells. Conclusion ·This research first reports the differences between KRAS4A^G12C and KRAS4B^G12C in promoting BEAS-2B cells proliferation and migration, and the underlying mechanism. The oncogenic mutant KRAS4B^G12C drives cell migration more significantly than KRAS4A^G12C does, which may be related to the expression level of CLDN1 and CADM3. Our study provides insights for the design of KRAS-specific targeting inhibitors and individualized therapy for non-small cell lung carcinoma patients harboring KRAS4A^G12Cand KRAS4B^G12C.

Key words: KRAS protein, human, protein isoform, cell adhesion, cell movement, lung neoplasm

CLC Number:

R730.2

ZOU Jinghua, GONG Miaomiao, SHEN Ying. Effects and mechanisms of KRAS4A^G12C and KRAS4B^G12C in the proliferation and migration of human pulmonary epithelial cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 1016-1023.

Figures/Tables 4

Tab 1 Sequences of primers for qPCR

Gene

Primer sequence（5'→3'）

CLDN1

F：TCTTGCAGGTCTGGCTATTTTA

R：TTGGGTAAGAGGTTGTTTTTCG

CADM3

F： AGAGTGCCCTGATCTTCCCTTTCC

R： GTGGTAGGTGCTGGAGGAGGAG

β-actin

F： CGGGAAATCGTGCGTGAC

R： TGGAAGGTGGACAGCGAGG

Fig 1 Effects of KRAS4AG12C or KRAS4BG12C overexpression on pulmonary epithelial cells morphology and proliferation

Fig 2 Effects of KRAS4AG12C or KRAS4BG12C overexpression on pulmonary epithelial cells migration

Fig 3 Effects of KRAS4AG12C or KRAS4BG12C overexpression on the mRNA levels of CLDN1 and CADM3

TrendMD

References 26

1	TURNER M C, ANDERSEN Z J, BACCARELLI A, et al. Outdoor air pollution and cancer: an overview of the current evidence and public health recommendations[J]. CA A Cancer J Clin, 2020, 70(6): 460-479.
2	TSAY J C J, WU B G, SULAIMAN I, et al. Lower airway dysbiosis affects lung cancer progression[J]. Cancer Discov, 2021, 11(2): 293-307.
3	BIRKBAK N J, MCGRANAHAN N. Cancer genome evolutionary trajectories in metastasis[J]. Cancer Cell, 2020, 37(1): 8-19.
4	BERGERS G, FENDT S M. The metabolism of cancer cells during metastasis[J]. Nat Rev Cancer, 2021, 21(3): 162-180.
5	PRIOR I A, LEWIS P D, MATTOS C. A comprehensive survey of Ras mutations in cancer[J]. Cancer Res, 2012, 72(10): 2457-2467.
6	FERNÁNDEZ-MEDARDE A, SANTOS E. Ras in cancer and developmental diseases[J]. Genes Cancer, 2011, 2(3): 344-358.
7	AACR Project GENIE Consortium. AACR project GENIE: powering precision medicine through an international consortium[J]. Cancer Discov, 2017, 7(8): 818-831.
8	MOORE A R, ROSENBERG S C, MCCORMICK F, et al. RAS-targeted therapies: is the undruggable drugged? [J]. Nat Rev Drug Discov, 2020, 19(8): 533-552.
9	KESSLER D, GMACHL M, MANTOULIDIS A, et al. Drugging an undruggable pocket on KRAS[J]. Proc Natl Acad Sci USA, 2019, 116(32): 15823-15829.
10	LI S Q, BALMAIN A, COUNTER C M. A model for RAS mutation patterns in cancers: finding the sweet spot[J]. Nat Rev Cancer, 2018, 18(12): 767-777.
11	ZHANG B Y, ZHANG Y, ZHANG J W, et al. Focal adhesion kinase (FAK) inhibition synergizes with KRAS G12C inhibitors in treating cancer through the regulation of the FAK-YAP signaling[J]. Adv Sci (Weinh), 2021, 8(16): e2100250.
12	VIGIL D, CHERFILS J, ROSSMAN K L, et al. Ras superfamily GEFs and GAPs: validated and tractable targets for cancer therapy?[J]. Nat Rev Cancer, 2010, 10(12): 842-857.
13	BOS J L, REHMANN H, WITTINGHOFER A. GEFs and GAPs: critical elements in the control of small G proteins[J]. Cell, 2007, 129(5): 865-877.
14	AHEARN I M, HAIGIS K, BAR-SAGI D, et al. Regulating the regulator: post-translational modification of RAS[J]. Nat Rev Mol Cell Biol, 2011, 13(1): 39-51.
15	PELLS S, DIVJAK M, ROMANOWSKI P, et al. Developmentally-regulated expression of murine K-ras isoforms[J]. Oncogene, 1997, 15(15): 1781-1786.
16	TSAI F D, LOPES M S, ZHOU M, et al. K-Ras4A splice variant is widely expressed in cancer and uses a hybrid membrane-targeting motif[J]. Proc Natl Acad Sci U S A, 2015, 112(3): 779-784.
17	SIMANSHU D K, NISSLEY D V, MCCORMICK F. RAS proteins and their regulators in human disease[J]. Cell, 2017, 170(1): 17-33.
18	SMITH M J, NEEL B G, IKURA M. NMR-based functional profiling of RASopathies and oncogenic RAS mutations[J]. Proc Natl Acad Sci USA, 2013, 110(12): 4574-4579.
19	HANCOCK J F. Ras proteins: different signals from different locations[J]. Nat Rev Mol Cell Biol, 2003, 4(5): 373-384.
20	AMENDOLA C R, MAHAFFEY J P, PARKER S J, et al. KRAS4A directly regulates hexokinase 1[J]. Nature, 2019, 576(7787): 482-486.
21	WANG M T, HOLDERFIELD M, GALEAS J, et al. K-ras promotes tumorigenicity through suppression of non-canonical Wnt signaling[J]. Cell, 2015, 163(5): 1237-1251.
22	SUBRAMANIAN A, TAMAYO P, MOOTHA V K, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles[J]. Proc Natl Acad Sci USA, 2005, 102(43): 15545-15550.
23	LANMAN B A, ALLEN J R, ALLEN J G, et al. Discovery of a covalent inhibitor of KRASG12C (AMG 510) for the treatment of solid tumors[J]. J Med Chem, 2020, 63(1): 52-65.
24	DHAWAN P, SINGH A B, DEANE N G, et al. Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer[J]. J Clin Investig, 2005, 115(7): 1765-1776.
25	SUN B S, YAO Y Q, PEI B X, et al. Claudin-1 correlates with poor prognosis in lung adenocarcinoma[J]. Thorac Cancer, 2016, 7(5): 556-563.
26	CHEN W Z, HUANG JF, XIONG J B, et al. Identification of a tumor microenvironment-related gene signature indicative of disease prognosis and treatment response in colon cancer[J]. Oxid Med Cell Longev, 2021, 2021: 6290261.

[1]	MENG Guo-hao, HE Xin-heng, LU Shao-yong. Prediction of signalling pathway of synaptic cell adhesion molecules mediating early synapse formation based on bioinformatics [J]. , 2019, 39(12): 1366-.
[2]	QIAN Tian-wei, WANG Ying. Application progresses in measuring cell adhesion by micropipette aspiration assay [J]. , 2016, 36(10): 1517-.
[3]	LIANG Wei, WU Chun-fang, YANG Hui, et al. Effects of different applications of statins on ICAM-1, VCAM-1 and MCP-1 in patients with coronary heart diseases [J]. , 2011, 31(2): 208-.
[4]	WU Dan-hong, ZHONG Ping, BAO Guan-shui, et al. Effects of different doses of topiramate on expression of NCAM and GAP-43 mRNA in hippocampus of rats with epilepsy [J]. , 2009, 29(12): 1459-.