Role of APOBEC3B in regulating replication stress of uveal melanoma

doi:10.3969/j.issn.1674-8115.2022.08.008

Abstract

Abstract:

Objective ·To explore the biological function of apolipoprotein B mRNA editing enzyme catalytic subunit 3B (APOBEC3B) in uveal melanoma (UM) and its impact on drug sensitivity. Methods ·The expression of APOBEC3B in ocular melanoma [UM and conjunctival melanoma (CM)] tissues and cell lines were verified by immunohistochemical staining and Western blotting, respectively. The association between APOBEC3B expression and prognosis in UM was analyzed by searching The Cancer Genome Atlas (TCGA) database. In order to construct the OMM2.3-APOBEC3B knockout cell line sgAPOBEC3B and control cell line Vector, the CRISPR-Cas9 plasmid APOBEC3B-sgRNA targeting APOBEC3B gene was designed. Colony formation assay was used to examine the effect of APOBEC3B knockout on OMM2.3 cell proliferation. At the same time, plasmid APOBEC3B-shRNA targeting APOBEC3B gene was designed to construct the OMM2.3-APOBEC3B knockdown cell line shAPOBEC3B and control cell line shCtrl. Differential genes of shAPOBEC3B and shCtrl cell line were detected by RNA sequencing (RNA-seq), the result of which was analyzed by gene set enrichment analysis (GSEA) in order to find the downstream pathways APOBEC3B involved in. Key downstream protein of downstream pathway was identified by immunofluorescence staining. Then targeted drugs of this pathway were applied to examine the effect of APOBEC3B on drug sensitivity in UM treatment. Results ·Immunohistochemical staining results showed that ocular melanoma (UM and CM) tissues had higher APOBEC3B expression than benign pigmented nevus tissues. Western blotting also showed that most ocular melanoma cells, including OMM2.3 cells, expressed higher levels of APOBEC3B compared to normal control cells, retinal pigment epithelium cells. Also, TCGA database analysis showed that UM patients with higher APOBEC3B expression had shorter overall survival (P=0.032) and disease-free survival (P=0.000). However, APOBEC3B knockout did not affect the colony formation ability of OMM2.3 cells, nor did APOBEC3B knockdown cause significant changes in the cell cycle. Differential gene enrichment analysis on the RNA-seq results of shAPOBEC3B and shCtrl cells showed that APOBEC3B regulated replication stress-related pathways in OMM2.3 cells. The heat map also showed that the gene expression of DNA replication stress-related pathways altered after APOBEC3B knockdown. Immunofluorescence staining showed that the level of phosphorylated replication protein A 32 kDa subunit (RPA32), a key target of replication stress pathway, was decreased after APOBEC3B knockdown. In drug sensitivity experiments on shAPOBEC3B and shCtrl OMM2.3 cells, it was found that OMM2.3 cells with APOBEC3B expression were more sensitive to cell cycle checkpoint kinase 1 (CHK1) inhibitor. Conclusion ·APOBEC3B is involved in regulating the replication stress-related pathways of OMM2.3 cells, and APOBEC3B-expressing OMM2.3 cells are more sensitive to the treatment of CHK1 inhibitor.

Key words: apolipoprotein B mRNA editing enzyme catalytic subunit 3B (APOBEC3B), uveal melanoma (UM), replication stress, cell cycle checkpoint kinase 1 (CHK1) inhibitor

CLC Number:

R773.4

ZONG Chunyan, HE Jie, ZHANG Zhe, JIA Renbing, SHEN Jianfeng. Role of APOBEC3B in regulating replication stress of uveal melanoma[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 1034-1044.

Figures/Tables 5

TrendMD

References 31

1	SWANTON C, MCGRANAHAN N, STARRETT G J, et al. APOBEC enzymes: mutagenic fuel for cancer evolution and heterogeneity[J]. Cancer Discov, 2015, 5(7): 704-712.
2	ROBERTS S A, LAWRENCE M S, KLIMCZAK L J, et al. An APOBEC cytidine deaminase mutagenesis pattern is widespread in human cancers[J]. Nat Genet, 2013, 45(9): 970-976.
3	ALEXANDROV L B, NIK-ZAINAL S, WEDGE D C, et al. Signatures of mutational processes in human cancer[J]. Nature, 2013, 500(7463): 415-421.
4	KUONG K J, LOEB L A. APOBEC3B mutagenesis in cancer[J]. Nat Genet, 2013, 45(9): 964-965.
5	BURNS M B, LACKEY L, CARPENTER M A, et al. APOBEC3B is an enzymatic source of mutation in breast cancer[J]. Nature, 2013, 494(7437): 366-370.
6	CESCON D W, HAIBE-KAINS B, MAK T W. APOBEC3B expression in breast cancer reflects cellular proliferation, while a deletion polymorphism is associated with immune activation[J]. Proc Natl Acad Sci USA, 2015, 112(9): 2841-2846.
7	SOUSA M M L, KROKAN H E, SLUPPHAUG G. DNA-uracil and human pathology[J]. Mol Aspects Med, 2007, 28(3/4): 276-306.
8	VENKATESAN S, ROSENTHAL R, KANU N, et al. Perspective: APOBEC mutagenesis in drug resistance and immune escape in HIV and cancer evolution[J]. Ann Oncol, 2018, 29(3): 563-572.
9	HOOPES J I, CORTEZ L M, MERTZ T M, et al. APOBEC3A and APOBEC3B preferentially deaminate the lagging strand template during DNA replication[J]. Cell Rep, 2016, 14(6): 1273-1282.
10	SEREBRENIK A A, STARRETT G J, LEENEN S, et al. The deaminase APOBEC3B triggers the death of cells lacking uracil DNA glycosylase[J]. Proc Natl Acad Sci USA, 2019, 116(44): 22158-22163.
11	SIEUWERTS A M, WILLIS S, BURNS M B, et al. Elevated APOBEC3B correlates with poor outcomes for estrogen-receptor-positive breast cancers[J]. Horm Cancer, 2014, 5(6): 405-413.
12	YAN S M, HE F, GAO B, et al. Increased APOBEC3B predicts worse outcomes in lung cancer: a comprehensive retrospective study[J]. J Cancer, 2016, 7(6): 618-625.
13	LAW E K, SIEUWERTS A M, LAPARA K, et al. The DNA cytosine deaminase APOBEC3B promotes tamoxifen resistance in ER-positive breast cancer[J]. Sci Adv, 2016, 2(10): e1601737.
14	XU L, CHANG Y, AN H M, et al. High APOBEC3B expression is a predictor of recurrence in patients with low-risk clear cell renal cell carcinoma[J]. Urol Oncol, 2015, 33(8): 340.e1-340.e8.
15	SEREBRENIK A A, ARGYRIS P P, JARVIS M C, et al. The DNA cytosine deaminase APOBEC3B is a molecular determinant of platinum responsiveness in clear cell ovarian cancer[J]. Clin Cancer Res, 2020, 26(13): 3397-3407.
16	MCLAUGHLIN C C, WU X C, JEMAL A, et al. Incidence of noncutaneous melanomas in the US[J]. Cancer, 2005, 103(5): 1000-1007.
17	BLUM E S, YANG J, KOMATSUBARA K M, et al. Clinical management of uveal and conjunctival melanoma[J]. Oncology (Williston Park), 2016, 30(1): 29-32, 34-43, 48.
18	JAGER M J, SHIELDS C L, CEBULLA C M, et al. Uveal melanoma[J]. Nat Rev Dis Primers, 2020, 6(1): 24.
19	SALAMANGO D J, MCCANN J L, DEMIR Ö, et al. APOBEC3B nuclear localization requires two distinct N-terminal domain surfaces[J]. J Mol Biol, 2018, 430(17): 2695-2708.
20	TSUBOI M, YAMANE A, HORIGUCHI J, et al. APOBEC3B high expression status is associated with aggressive phenotype in Japanese breast cancers[J]. Breast Cancer, 2016, 23(5): 780-788.
21	XIA S Y, GU Y, ZHANG H J, et al. Immune inactivation by APOBEC3B enrichment predicts response to chemotherapy and survival in gastric cancer[J]. Oncoimmunology, 2021, 10(1): 1975386.
22	GARA S K, TYAGI M V, PATEL D T, et al. GATA3 and APOBEC3B are prognostic markers in adrenocortical carcinoma and APOBEC3B is directly transcriptionally regulated by GATA3[J]. Oncotarget, 2020, 11(36): 3354-3370.
23	HIRABAYASHI S, SHIRAKAWA K, HORISAWA Y, et al. APOBEC3B is preferentially expressed at the G2/M phase of cell cycle[J]. Biochem Biophys Res Commun, 2021, 546: 178-184.
24	NIKKILÄ J, KUMAR R, CAMPBELL J, et al. Elevated APOBEC3B expression drives a kataegic-like mutation signature and replication stress-related therapeutic vulnerabilities in p53-defective cells[J]. Br J Cancer, 2017, 117(1): 113-123.
25	CESCON D W, HAIBE-KAINS B. DNA replication stress: a source of APOBEC3B expression in breast cancer[J]. Genome Biol, 2016, 17(1): 202.
26	MACHERET M, HALAZONETIS T D. DNA replication stress as a hallmark of cancer[J]. Annu Rev Pathol, 2015, 10: 425-448.
27	BUISSON R, LAWRENCE M S, BENES C H, et al. APOBEC3A and APOBEC3B activities render cancer cells susceptible to ATR inhibition[J]. Cancer Res, 2017, 77(17): 4567-4578.
28	ASHLEY A K, SHRIVASTAV M, NIE J Y, et al. DNA-PK phosphorylation of RPA32 Ser4/Ser8 regulates replication stress checkpoint activation, fork restart, homologous recombination and mitotic catastrophe[J]. DNA Repair (Amst), 2014, 21: 131-139.
29	REAPER P M, GRIFFITHS M R, LONG J M, et al. Selective killing of ATM- or p53-deficient cancer cells through inhibition of ATR[J]. Nat Chem Biol, 2011, 7(7): 428-430.
30	TOLEDO L I, MURGA M, ZUR R, et al. A cell-based screen identifies ATR inhibitors with synthetic lethal properties for cancer-associated mutations[J]. Nat Struct Mol Biol, 2011, 18(6): 721-727.
31	KANU N, CERONE M A, GOH G, et al. DNA replication stress mediates APOBEC3 family mutagenesis in breast cancer[J]. Genome Biol, 2016, 17: 185.

Primer name	Forward （5'→3'）	Reverse （5'→3'）
APOBEC3B	CGCCAGACCTACTTGTGCTAT	CATTTGCAGCGCCTCCTTAT
GAPDH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA
CCNH	TGTTCGGTGTTTAAGCCAGCA	TCCTGGGGTGATATTCCATTACT
HEXB	CTCGCCCCGGAGAACTTCTA	GAAAGCATCACACTCTGACTGA
IGFBP3	AGAGCACAGATACCCAGAACT	GGTGATTCAGTGTGTCTTCCATT
DCT	CTTGGGCTGCAAAATCCTGC	CAGCACTCCTTGTTCACTAGG
CDKN1C	GCGGCGATCAAGAAGCTGT	GCTTGGCGAAGAAATCGGAGA
EIF3C	ATGTCGCGGTTTTTCACCAC	GCGGACAACTCTCTTGGTATCT

Primer name	Forward （5'→3'）	Reverse （5'→3'）
APOBEC3B	CGCCAGACCTACTTGTGCTAT	CATTTGCAGCGCCTCCTTAT
GAPDH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA
CCNH	TGTTCGGTGTTTAAGCCAGCA	TCCTGGGGTGATATTCCATTACT
HEXB	CTCGCCCCGGAGAACTTCTA	GAAAGCATCACACTCTGACTGA
IGFBP3	AGAGCACAGATACCCAGAACT	GGTGATTCAGTGTGTCTTCCATT
DCT	CTTGGGCTGCAAAATCCTGC	CAGCACTCCTTGTTCACTAGG
CDKN1C	GCGGCGATCAAGAAGCTGT	GCTTGGCGAAGAAATCGGAGA
EIF3C	ATGTCGCGGTTTTTCACCAC	GCGGACAACTCTCTTGGTATCT