lncRNA NEAT1 affects the proliferation, invasion and migration of ox-LDL-induced human vascular smooth muscle cells through miR-377-3p/Wnt pathway

doi:10.3969/j.issn.1674-8115.2022.11.003

Abstract

Abstract:

Objective ·To study the effects of long non-coding RNA (lncRNA) nuclear paraspeckle assembly transcript 1 (NEAT1) on the proliferation, invasion and migration of oxidized low-density lipoprotein (ox-LDL)-induced human vascular smooth muscle cells (HVSMCs) through regulating microRNA-377-3p (miR-377-3p) /Wnt pathway. Methods ·HVSMCs cultured in vitro were treated with 100 μg/mL ox-LDL. HVSMCs were randomly divided into control group, model group, NEAT1 siRNA group, miR-377-3p inhibitor group, transfection+inhibitor (NEAT1 siRNA+miR-377-3p inhibitor) group, and transfection-negative control (NEAT1 siRNA-negative control) group. Except for the control group, the atherosclerosis cell models were induced with 100 μg/mL ox-LDL in other groups. After grouping and transfection, the cell viability of each group was determined by using cell counting kit-8 (CCK-8) experiment; the apoptosis rate of each group was measured by flow cytometry; the migration and invasion of cells in each group were evaluated by the Transwell experiment; the expression of cell proliferation markers such as proliferating cell nuclear antigen (PCNA), and epithelial-mesenchymal transition (EMT) markers, such as E-cadherin and vimentin in each group, was determined by immunoblotting experiment; the expression of NEAT1, miR-377-3p and wingless-related MMTV integration site 5A (WNT5A) mRNA in each group was determined by qRT-PCR experiment. Results ·Compared with the control group, the mRNA expression of NEAT1 in the model group increased, the mRNA expression of miR-377-3p decreased, the apoptosis rate decreased, the cell viability, and the number of migrating and invasive cells increased, the protein expression of PCNA and Vimentin increased, the expression of E-cadherin decreased, and WNT5A mRNA expression increased (all P=0.000). After NEAT1 was interfered, the apoptosis rate increased, the cell viability, and the number of migrating and invasive cells decreased, the protein expression of PCNA and Vimentin decreased, the expression of E-cadherin increased, and WNT5A mRNA expression decreased (all P=0.000); after miR-377-3p was inhibited, all the above indicators showed opposite expression trends (P<0.05). In addition, inhibition of miR-377-3p reversed the regulation of NEAT1 interference on cell proliferation, invasion, migration and apoptosis (all P=0.000). Conclusion ·The down-regulating of NEAT1 expression may increase miR-377-3p expression by competitive binding to miR-377-3p, reduce protein expression associated with the Wnt pathway, inhibit the abnormal proliferation, invasion and migration of HVSMCs induced by ox-LDL, and induce apoptosis.

Key words: long non-coding RNA (lncRNA), nuclear paraspeckle assembly transcript 1 (NEAT1), microRNA-377-3p (miR-377-3p), human vascular smooth muscle cell (HVSMC), proliferation, invasion and migration

CLC Number:

R543.5

YUAN Yongmei, CHENG Xiaodan, SUN Jiaan, CHANG Dongge, HE Yingying, LIU Chang. lncRNA NEAT1 affects the proliferation, invasion and migration of ox-LDL-induced human vascular smooth muscle cells through miR-377-3p/Wnt pathway[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(11): 1534-1541.

Figures/Tables 8

Tab 1 Primer sequences of each gene

Gene	Forward sequence （5'→3'）	Reverse sequence （5'→3'）
NEAT1	CAATGACTTGGGGATGATGCAAACAATTACTG	GTACTCCCCACCTACACACCCAC
WNT5A	GCGGGACTTTCTCAAGGACA	CGGCTGCCTATTTGCATCAC
β-actin	AGTGCGACGTGGACATCCG	TGGCTCTAACAGTCCGCCTAG
miR-377-3p	GGGAATCACACAAAGGCAAC	GTGCGTGTCGTGGAGTCG
U6	GCTTCGGCAGCACATATACTAAAAT	CGCTTCAGAATTTGCGTGTCAT

Fig 1 Relative expression of NEAT1, miR-377-3p and WNT5A mRNA in each group of cells (n=6)

Fig 2 Detection of apoptosis in each group by flow cytometry

Fig 3 Cell invasion in each group was detected by Transwell migration test

Fig 4 Cell migration was detected by Transwell invasion test

Fig 5 Number of invasive and migrating cells in each group

Fig 6 Western blotting detection of cell proliferation and EMT marker proteins expression in each groupNote: A. Control group. B. Model group. C. NEAT1 siRNA group. D. miR-377-3p inhibitor group. E. Transfection negative control group. F. Transfection+inhibition group.

Fig 7 Relative expression of PCNA, E-cadherin and vimentin proteins in each group of cells

TrendMD

References 21

1	DONG Y, CHEN H W, GAO J L, et al. Molecular machinery and interplay of apoptosis and autophagy in coronary heart disease[J]. J Mol Cell Cardiol, 2019, 136: 27-41.
2	BENNETT M R, SINHA S, OWENS G K. Vascular smooth muscle cells in atherosclerosis[J]. Circ Res, 2016, 118(4): 692-702.
3	FENG Z B, ZHU Y P, ZHANG J, et al. Hsa-circ_0010283 regulates oxidized low-density lipoprotein-induced proliferation and migration of vascular smooth muscle cells by targeting the miR-133a-3p/pregnancy-associated plasma protein A axis[J]. Circ J, 2020, 84(12): 2259-2269.
4	ZOU L, XIA P F, CHEN L, et al. XIST knockdown suppresses vascular smooth muscle cell proliferation and induces apoptosis by regulating miR-1264/WNT5A/β-catenin signaling in aneurysm[J]. Biosci Rep, 2021, 41(3): BSR20201810.
5	LI H R, ZHAO Q F, CHANG L P, et al. LncRNA MALAT1 modulates ox-LDL induced EndMT through the Wnt/β-catenin signaling pathway[J]. Lipids Health Dis, 2019, 18(1): 62.
6	AHMED A S I, DONG K Z, LIU J H, et al. Long noncoding RNA NEAT1 (nuclear paraspeckle assembly transcript 1) is critical for phenotypic switching of vascular smooth muscle cells[J]. Proc Natl Acad Sci USA, 2018, 115(37): E8660-E8667.
7	ZHANG X, GUAN M X, JIANG Q H, et al. NEAT1 knockdown suppresses endothelial cell proliferation and induces apoptosis by regulating miR‑638/AKT/mTOR signaling in atherosclerosis[J]. Oncol Rep, 2020, 44(1): 115-125.
8	ZHAO L, BI M H, ZHANG H R, et al. Downregulation of NEAT1 suppresses cell proliferation, migration, and invasion in NSCLC via sponging miR-153-3p[J]. Cancer Biother Radiopharm, 2020, 35(5): 362-370.
9	LI T Y, DENG N H, XU R M, et al. NEAT1 siRNA packed with chitosan nanoparticles regulates the development of colon cancer cells via lncRNA NEAT1/miR-377-3p axis[J]. Biomed Res Int, 2021, 2021: 5528982.
10	ZHANG J S, LI Y L, DONG M, et al. Long non-coding RNA NEAT1 regulates E2F3 expression by competitively binding to miR-377 in non-small cell lung cancer[J]. Oncol Lett, 2017, 14(4): 4983-4988.
11	ZHANG P, WANG W P, LI M L. Circ_0010283/miR-377-3p/cyclin D1 axis is associated with proliferation, apoptosis, migration, and inflammation of oxidized low-density lipoprotein-stimulated vascular smooth muscle cells[J]. J Cardiovasc Pharmacol, 2021, 78(3): 437-447.
12	LIANG K, LIAO L, LIU Q, et al. microRNA-377-3p inhibits osteosarcoma progression by targeting CUL1 and regulating Wnt/β-catenin signaling pathway[J]. Clin Transl Oncol, 2021, 23(11): 2350-2357.
13	HUANG L F, LIU Z B, HU J, et al. miR-377-3p suppresses colorectal cancer through negative regulation on Wnt/β-catenin signaling by targeting XIAP and ZEB2[J]. Pharmacol Res, 2020, 156: 104774.
14	PARK N, KANG H. BMP-induced microRNA-101 expression regulates vascular smooth muscle cell migration[J]. Int J Mol Sci, 2020, 21(13): 4764.
15	ZHANG M, WANG X T, YAO J, et al. Long non-coding RNA NEAT1 inhibits oxidative stress-induced vascular endothelial cell injury by activating the miR-181d-5p/CDKN₃ axis[J]. Artif Cells Nanomed Biotechnol, 2019, 47(1): 3129-3137.
16	YU X Y, LIU X Y, WANG R, et al. Long non-coding RNA NEAT1 promotes the progression of hemangioma via the miR-361-5p/VEGFA pathway[J]. Biochem Biophys Res Commun, 2019, 512(4): 825-831.
17	WANG L, XIA J W, KE Z P, et al. Blockade of NEAT1 represses inflammation response and lipid uptake via modulating miR-342-3p in human macrophages THP-1 cells[J]. J Cell Physiol, 2019, 234(4): 5319-5326.
18	LI B, XU W W, HAN L, et al. microRNA-377 suppresses initiation and progression of esophageal cancer by inhibiting CD133 and VEGF[J]. Oncogene, 2017, 36(28): 3986-4000.
19	SUN C C, LI S J, ZHANG F, et al. Long non-coding RNA NEAT1 promotes non-small cell lung cancer progression through regulation of miR-377-3p-E2F3 pathway[J]. Oncotarget, 2016, 7(32): 51784-51814.
20	LIU D, WANG X Y, ZHANG M J, et al. WISP1 alleviates lipid deposition in macrophages via the PPARγ/CD36 pathway in the plaque formation of atherosclerosis[J]. J Cell Mol Med, 2020, 24(20): 11729-11741.
21	LIU Y S, WEI M, LIU G, et al. Silencing protease-activated receptor-2 alleviates ox-LDL-induced lipid accumulation, inflammation and apoptosis via activation of Wnt/β-catenin signaling[J]. Gen Physiol Biophys, 2020, 39(5): 437-448.

[1]	DING He, CAO Yanglin, HE Yang, WEI Xing, YANG Jianfeng. SMAD7 expression in multiple myeloma and its effect on cell proliferation and drug resistance [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 858-865.
[2]	HU Zhexuan, ZHANG Xin, WO Lulu, LI Jingchi, WANG Jiao, ZHOU Cixiang, ZHAO Qian. Study on the function of TRMT61A in liver cancer cell and its mechanism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 742-750.
[3]	XU Feixiang, WANG Sheng, XUE Mingming, TONG Chaoyang, CHEN Yumei. Effect of altered expression of long non-coding RNA-B230352I09 on proliferation and cycle of H9C2 cardiomyocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 578-582.
[4]	LIU Ziyang, WANG Xiaowen, CHEN Li. lncRNA GK-IT1 influences the carcinogenesis of non-small cell lung cancer cells through regulating aldolase A [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 591-601.
[5]	Ming CHEN, Jing ZHANG. Inhibitory effect of sanguinarine on proliferaton and invasion of gastric cancer cells by upregulating m⁶A methyltransferase 14 [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 135-141.
[6]	Bing-qian ZHOU, Li HAN, Zhe-yi CHEN, Shi-yu CHEN, Ying-xia ZHENG. Expression of protein arginine methyltransferase 5 in lung cancer and its mechanism of promoting lung cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1009-1016.
[7]	Yan-qi HE, Rui CHI, Meng-ping CHEN, Si CHEN, Chun-liang LIU, Yun-xia LIU, Hai-peng SUN. Function of branched-chain amino acid catabolism in lung cancer cells [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 858-864.
[8]	Xu TONG, Lin-jing SHU. Effect of miR-877-3p on proliferation of bone marrow mesenchymal stem cells in osteoporosis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 884-890.
[9]	Shu-jun WAN, Xiang KONG, Kun LÜ. Relationship between non-coding RNAs and vascular diseases of diabetes mellitus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(5): 665-670.
[10]	YAN Yu-qing, SHEN Chao-qin, CHEN Hao-yan, HONG Jie#, WANG Zhen-hua#. Expression of lnc-MTBP-5 in colorectal cancer and its effect on cell invasion [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1193-1201.
[11]	DOU Min1, 2, ZHENG Ying-xia2, HAN Li2, ZHAO Qian1. Role and mechanism of PRMT4 in genesis and progression of gastric cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(5): 609-618.
[12]	CHENG Long, XU Wu-qin, ZHANG Peng, HUANG Jian-jun, LI Xiao-ning. Effect of miR-27a down-regulation on proliferation, migration and invasion in triple-negative breast cancer cells [J]. , 2020, 40(2): 188-.
[13]	ZHANG Peng1, CHANG Zheng-yan2, YANG Lei1, XUE Song1, LIAN Feng1. Bioinformatics analysis of differentially expressed genes in ischemic cardiomyopathy [J]. , 2019, 39(7): 698-.
[14]	HONG Xi1, LIU Li-jie1, HUANG Xian-yu2, LUO Jing2, YU Jian-jun1. Effects of BRD4 inhibitor on histone crotonylation, proliferation and migration of prostate cancer cells [J]. , 2019, 39(7): 721-.
[15]	NING Hang, XIA Yi-ru, DONG Jia-chen, SHU Rong. Effect of recombinant human amelogenin-loaded PCLA-PEG-PCLA hydrogels on biological properties of human periodontal ligament fibroblasts [J]. , 2019, 39(3): 244-.