FBXO38 regulates ocular melanoma proliferation through the PI3K-Akt signaling pathway

doi:10.3969/j.issn.1674-8115.2023.12.002

Abstract

Abstract:

Objective ·To investigate the effect of F-box only protein 38 (FBXO38) on the ocular melanoma proliferation and the potential regulatory pathway. Methods ·Human skin cutaneous melanoma A375 and human uveal melanoma OMM2.3 cell lines with FBXO38 knockdown and overexpression were constructed by FBXO38 short hairpin RNA (shRNA) and FBXO38 overexpression plasmids respectively. Knockdown and overexpression efficiency of FBXO38 at transcription and protein levels were verified by using quantitative real-time PCR (qRT-PCR) and Western blotting. The effects of FBXO38 on melanoma cell proliferation were detected through clonal formation assay, BrdU immunofluorescence staining and CCK8 cell proliferation assay. By using The Cancer Genome Atlas (TCGA) database, differentially expressed genes were analyzed in the high and low expression groups of FBXO38. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment was performed to reveal the signaling pathways associated with FBXO38. CCK8 cell proliferation assay was used to detect the inhibition rates of the signaling pathway inhibitors on cells with different FBXO38 expression levels. qRT-PCR and Western blotting were used to detect whether the signaling pathway was activated after knocking down FBXO38. Results ·qRT-PCR and Western blotting verified that mRNA and protein expression levels of FBXO38 in FBXO38 knockdown A375 and OMM2.3 cell lines decreased compared with the control group, while the expression levels of FBXO38 in the overexpression cell lines increased compared with wild type group (P<0.05). Clonal formation assay, BrdU immunofluorescence staining and CCK8 cell proliferation assay showed that FBXO38 knockdown significantly enhanced the proliferation of A375 and OMM2.3 cells (P<0.05), while overexpression of FBXO38 inhibited melanoma cell proliferation (P<0.05). Enrichment analysis showed that in skin cutaneous melanoma and uveal melanoma, FBXO38 expression influenced the phosphoinositide 3-kinase/protein kinase B (PI3K-Akt) pathway activation. Compared with those in the control group, the inhibition rates of PI3K inhibitor LY294002 and mTOR1 inhibitor Everolimus in the FBXO38 knockdown group significantly improved (P<0.05), while their inhibition rates of the overexpression group significantly decreased compared with those of control cells (P<0.05). Western blotting results showed that after knocking down FBXO38, expression levels of PTEN, P21 and P53 proteins decreased, while expression level of MDM2 protein increased. The qRT-PCR results showed a significant decrease in P53 transcription level (P<0.05) and a significant increase in MDM2 transcription level in FBXO38 knockdown cells (P<0.05). Conclusion ·FBXO38 plays a role in regulating the proliferation of ocular melanoma, and this regulatory effect is related to the PI3K-Akt signaling pathway.

Key words: F-box only protein 38 (FBXO38), ocular melanoma, PI3K-Akt signaling pathway, tumor proliferation

CLC Number:

R739.7

WU Yijia, FANG Yan, SHEN Feiyang, HUANG Rui, SHEN Jianfeng, FAN Xianqun. FBXO38 regulates ocular melanoma proliferation through the PI3K-Akt signaling pathway[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1470-1479.

Figures/Tables 5

Tab 1 Primer sequences for qRT-PCR

Primer	Forward (5′→3′)	Reverse (5′→3′)
FBXO38	AACGGTACTCGGCGTTACTC	TGTTTTGGCTACTTCTGACAATTC
ACTIN	CTCCATCCTGGCCTCGCTGT	GCTGTCACCTTCACCGTTCC
MDM2	AGGAGATTTGTTTGGCGTGC	TGAGTCCGATGATTCCTGCTG
TP53	AAGTCTAGAGCCACCGTCCA	CAGTCTGGCTGCCAATCCA

Fig 1 Construction of FBXO38 knockdown and overexpression cell lines

Fig 2 Effect of FBXO38 knockdown or overexpression on the proliferation of melanoma cells

Fig 3 Enrichment analysis ofdifferentially expressed genes associated with FBXO38

Fig 4 Regulation of FBXO38 on the PI3K-Akt signaling pathway and downstream molecular

TrendMD

References 28

1	TEKCHAM D S, CHEN D, LIU Y, et al. F-box proteins and cancer: an update from functional and regulatory mechanism to therapeutic clinical prospects[J]. Theranostics, 2020, 10(9): 4150-4167.
2	SMALDONE S, LAUB F, ELSE C, et al. Identification of MoKA, a novel F-box protein that modulates Krüppel-like transcription factor 7 activity[J]. Mol Cell Biol, 2004, 24(3): 1058-1069.
3	SMALDONE S, RAMIREZ F. Multiple pathways regulate intracellular shuttling of MoKA, a co-activator of transcription factor KLF7[J]. Nucleic Acids Res, 2006, 34(18): 5060-5068.
4	MENG X B, LIU X W, GUO X D, et al. FBXO38 mediates PD-1 ubiquitination and regulates anti-tumour immunity of T cells[J]. Nature, 2018, 564(7734): 130-135.
5	CHAR D H. Ocular melanoma[J]. Surg Clin N Am, 2003, 83(2): 253-274.
6	KIRCHBERGER M C, MOREIRA A, ERDMANN M, et al. Real world experience in low-dose ipilimumab in combination with PD-1 blockade in advanced melanoma patients[J]. Oncotarget, 2018, 9(48): 28903-28909.
7	JAGER M J, SHIELDS C L, CEBULLA C M, et al. Uveal melanoma[J]. Nat Rev Dis Primers, 2020, 6(1): 24.
8	GRIMES J M, SHAH N V, SAMIE F H, et al. Conjunctival melanoma: current treatments and future options[J]. Am J Clin Dermatol, 2020, 21(3): 371-381.
9	LI X, ZHAI J, SHEN Y K, et al. Tumor-derived IL-8 facilitates lymph node metastasis of gastric cancer via PD-1 up-regulation in CD8⁺ T cells[J]. Cancer Immunol Immunother, 2022, 71(12): 3057-3070.
10	WANG Z, LIU P, INUZUKA H, et al. Roles of F-box proteins in cancer[J]. Nat Rev Cancer, 2014, 14(4): 233-247.
11	GEORGES A, COYAUD E, MARCON E, et al. USP7 regulates cytokinesis through FBXO38 and KIF20B[J]. Sci Rep, 2019, 9(1): 2724.
12	DIBUS N, KORINEK V, CERMAK L. FBXO38 ubiquitin ligase controls centromere integrity via ZXDA/B stability[J]. Front Cell Dev Biol, 2022, 10: 929288.
13	DIBUS N, ZOBALOVA E, MONLEON M A M, et al. FBXO38 ubiquitin ligase controls sertoli cell maturation[J]. Front Cell Dev Biol, 2022, 10: 914053.
14	AKÇIMEN F, VURAL A, DURMUŞ H, et al. A novel homozygous FBXO38 variant causes an early-onset distal hereditary motor neuronopathy type IID[J]. J Hum Genet, 2019, 64(11): 1141-1144.
15	CISAROVA K, FOLCHER M, EL ZAOUI I, et al. Genomic and transcriptomic landscape of conjunctival melanoma[J]. PLoS Genet, 2020, 16(12): e1009201.
16	VIGNA E, NALDINI L. Lentiviral vectors: excellent tools for experimental gene transfer and promising candidates for gene therapy[J]. J Gene Med, 2000, 2(5): 308-316.
17	LIANG J Y, SLINGERLAND J M. Multiple roles of the PI3K/PKB (Akt) pathway in cell cycle progression[J]. Cell Cycle, 2003, 2(4): 339-345.
18	WESTIN J R. Status of PI3K/Akt/mTOR pathway inhibitors in lymphoma[J]. Clin Lymphoma Myeloma Leuk, 2014, 14(5): 335-342.
19	DONG Y, RICHARDS J A, GUPTA R, et al. PTEN functions as a melanoma tumor suppressor by promoting host immune response[J]. Oncogene, 2014, 33(38): 4632-4642.
20	WANG R, TAHIRI H, YANG C, et al. MiR-181a-5p inhibits uveal melanoma development by targeting GNAQ and AKT3[J]. Am J Cancer Res, 2023, 13(1): 293-306.
21	NUNNERY S E, MAYER I A. Management of toxicity to isoform α-specific PI3K inhibitors[J]. Ann Oncol, 2019, 30: x21-x26.
22	HE Y, SUN M M, ZHANG G G, et al. Targeting PI3K/Akt signal transduction for cancer therapy[J]. Signal Transduct Target Ther, 2021, 6(1): 425.
23	YIP P Y. Phosphatidylinositol 3-kinase-AKT-mammalian target of rapamycin (PI3K-Akt-mTOR) signaling pathway in non-small cell lung cancer[J]. Transl Lung Cancer Res, 2015, 4(2): 165-176.
24	ACCILI D, ARDEN K C. FoxOs at the crossroads of cellular metabolism, differentiation, and transformation[J]. Cell, 2004, 117(4): 421-426.
25	VECINO R, BURGUETE M C, JOVER-MENGUAL T, et al. The MDM2-p53 pathway is involved in preconditioning-induced neuronal tolerance to ischemia[J]. Sci Rep, 2018, 8(1): 1610.
26	MAYO L D, DONNER D B. A phosphatidylinositol 3-kinase/Akt pathway promotes translocation of Mdm2 from the cytoplasm to the nucleus[J]. Proc Natl Acad Sci USA, 2001, 98(20): 11598-11603.
27	CANTLEY L C. The phosphoinositide 3-kinase pathway[J]. Science, 2002, 296(5573): 1655-1657.
28	KATSO R, OKKENHAUG K, AHMADI K, et al. Cellular function of phosphoinositide 3-kinases: implications for development, homeostasis, and cancer[J]. Annu Rev Cell Dev Biol, 2001, 17: 615-675.

[1]	ZHOU Xiaowen, LI Qian, ZHANG Zhe, SHEN Jianfeng, FAN Xianqun. RBX1 regulates uveal melanoma immune-related genes via STAT1 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 709-717.
[2]	YUAN Xiao-ling1, 2, HE Xiao-yu1, 2, LI Yong-yun1, 2, CHAI Pei-wei1, 2, WANG Hui-xue1, 2, JIA Ruo-bing1, 2, XU Yang-fan1, 2, SHANG Qing-feng1, 2, ZHAO Hong-bo1, 2, JIA Ren-bing1, 2. Establishment and genomic characterization of a novel retinoblastoma cell line without RB1 mutation derived a Han Chinese donor [J]. , 2018, 38(8): 865-.
[3]	FU Xiao1, HUANG Rui1, FAN Xian-qun2, ZHANG He2. Roles of long non-coding RNA in intraocular malignant tumor and its mechanisms [J]. , 2018, 38(6): 699-.
[4]	ZONG Chunyan, HE Jie, ZHANG Zhe, JIA Renbing, SHEN Jianfeng. Role of APOBEC3B in regulating replication stress of uveal melanoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 0, (): 1-11.