Construction and characterization of mice with conditional knockout of Stat3 gene in microglia

doi:10.3969/j.issn.1674-8115.2023.06.005

Abstract

Abstract:

Objective ·To construct mice with conditional knockout of Stat3 gene in microglia based on the Cre-Loxp system and validate their knockout efficiency. Methods ·Cx3cr1^creERT2 and Stat3^fl/flgenotypic mice were bred for conditional knockout mice (CKO) and Wild Type mice (WT). The mouse genotypes were determined by extracting DNA from mouse tissues through Polymerase Chain Reaction (PCR) combined with the amplification results of cre and flox primers. Stat3 knockdown was induced by intraperitoneal injection of tamoxifen in the CKO and WT mice at 6 weeks of age. The CKO mice (n=4) and WT mice (n=4) were randomly selected for the detection. After two weeks of observation, microglia cells were sorted out by Magnetic Activated Cell Sorting (MACS). Real-time PCR (RT-PCR) was used to detect gene knockout efficiency at the gene level. The expression of STAT3 in microglia was observed by brain immunofluorescence staining. The expression rate of STAT3 in microglia was detected by flow cytometry. The expression rate of STAT3 in macrophages of the spleen was detected by flow cytometry. The condition of neuronal cells was examined by Nissl staining. The condition of the microglia in the cortex and hippocampus was observed by brain immunofluorescence staining. The phenotype of the microglia was detected by flow cytometry. Results ·The CKO mice and WT mice were successfully bred. MACS boosted the proportion of microglia in brain cells from 10% to 85%. RT-PCR results showed that mRNA levels of Stat3 were down-regulated in microglia of CKO mice, compared with the WT mice (P=0.001). The relative mRNA expression of Stat3 in microglia of the CKO mice was 0.331 7±0.041 4. Immunofluorescence staining of brain tissues showed that the fluorescence intensity of STAT3 in microglia of the CKO mice was weaker than that of the WT mice. Flow cytometry of brain tissues showed that the STAT3-positive cells in microglia of the WT mice was (85.30±5.69)% and the CKO mice was (39.70±3.88)%. STAT3 expression was decreased in microglia of the CKO mice (P=0.001). Flow cytometry of spleen tissues showed that there was no statistical difference in the percentage of STAT3-positive cells in splenic macrophages between the CKO and WT mice (P>0.05). Nissl staining showed that there were no significant differences between the neuronal cells of the CKO mice and WT mice. Immunofluorescencestaining of brain tissues showed that there was no significant difference in the shape of microglia between the CKO mice and WT mice. Flow cytometry showed that the phenotype of microglia in the CKO mice was not remarkably different from that of the WT mice. Conclusion ·We successfully construct the STAT3 gene conditional knockout mice from microglia, which provides the foundation for subsequent related studies.

Key words: microglia, signal transducer and activator of transcription 3 (STAT3), tamoxifen, mice, Cre recombinase

CLC Number:

R781

ZHU Xiaochen, XIE Xinyi, ZHAO Xuri, XU Lina, HE Zhiyan, ZHOU Wei. Construction and characterization of mice with conditional knockout of Stat3 gene in microglia[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 689-698.

Figures/Tables 13

Tab 1 Primer sequence for PCR

Primer	Sequence (5'→3')	Primer Type
Cx3cr1	AAGACTCACGTGGACCTGCT	Common forward
	CGGTTATTCAACTTGCACCA	Mutant reverse
	AGGATGTTGACTTCCGAGTTG	Wild type reverse
Stat3	TTGACCTGTGCTCCTACAAAA	Forward A
	CCCTAGATTAGGCCAGCACA	Reverse A

Fig 1 Schematic diagram of the construction of mice

Tab 2 Location of genotype-specific primer bands

Primer	Genotype	Location
Cx3cr1	WT	695 bp
	Cx3cr1^creERT2	300 bp; 695 bp
Stat3	Stat3^fl/+	146 bp; 187 bp
	Stat3^fl/fl	187 bp

Fig2 Genotype identification of mice

Fig 3 Detection of microglial purity changes after MACS by flow cytometry

Fig 4 Stat3 mRNA expression in microglia

Fig5 Detection of changes in STAT3 expression in microglia by immunofluorescence

Fig 6 Detection of STAT3 changes in mice microglia by flow cytometry

Fig 7 Detection of STAT3 changes in mice splenic macrophage by flow cytometry

Fig 8 Detection of the changes in neurons by Nissl staining

Fig 9 Detection of the changes of microglia by immunofluorescence

Fig 10 Detection of the type in mice microglia by flow cytometry

Fig 11 Changes of M1 microglia/M2 microglia

TrendMD

References 19

1	PRINZ M, JUNG S, PRILLER J. Microglia biology: one century of evolving concepts[J]. Cell, 2019, 179(2): 292-311.
2	LI C Q, WANG Y, XING Y, et al. Regulation of microglia phagocytosis and potential involvement of exercise[J]. Front Cell Neurosci, 2022, 16: 953534.
3	HU S Y, LEE H, ZHAO H P, et al. Inflammation and severe cerebral venous thrombosis[J]. Front Neurol, 2022, 13: 873802.
4	YU F, WANG Y F, STETLER A R, et al. Phagocytic microglia and macrophages in brain injury and repair[J]. CNS Neurosci Ther, 2022, 28(9): 1279-1293.
5	KIM H, KIM M, IM S K, et al. Mouse Cre-LoxP system: general principles to determine tissue-specific roles of target genes[J]. Lab Anim Res, 2018, 34(4): 147-159.
6	HU Y S, HAN X, LIU X H. STAT3: a potential drug target for tumor and inflammation[J]. Curr Top Med Chem, 2019, 19(15): 1305-1317.
7	TOŠIĆ I, FRANK D A. STAT3 as a mediator of oncogenic cellular metabolism: pathogenic and therapeutic implications[J]. Neoplasia, 2021, 23(12): 1167-1178.
8	ZHENG Z V, CHEN J F, LYU H, et al. Novel role of STAT3 in microglia-dependent neuroinflammation after experimental subarachnoid haemorrhage[J]. Stroke Vasc Neurol, 2022, 7(1): 62-70.
9	LUO L, AMBROZKIEWICZ M C, BENSELER F, et al. Optimizing nervous system-specific gene targeting with cre driver lines: prevalence of germline recombination and influencing factors[J]. Neuron, 2020, 106(1): 37-65.e5.
10	NAVABPOUR S, KWAPIS J L, JAROME T J. A neuroscientist's guide to transgenic mice and other genetic tools[J]. Neurosci Biobehav Rev, 2020, 108: 732-748.
11	SIMONETTI M, YILMAZER A, KRETSCHMER K. Genetic tools for analyzing Foxp3⁺ treg cells: fluorochrome-based transcriptional reporters and genetic fate-mapping[J]. Methods Mol Biol, 2023, 2559: 95-114.
12	ABUBAKAR M B, SANUSI K O, UGUSMAN A, et al. Alzheimer's disease: an update and insights into pathophysiology[J]. Front Aging Neurosci, 2022, 14: 742408.
13	SHEN Y N, ZHANG Y, DU J Y, et al. CXCR5 down-regulation alleviates cognitive dysfunction in a mouse model of sepsis-associated encephalopathy: potential role of microglial autophagy and the p38MAPK/NF-κB/STAT3 signaling pathway[J]. J Neuroinflammation, 2021, 18(1): 246.
14	REICHENBACH N, DELEKATE A, PLESCHER M, et al. Inhibition of Stat3-mediated astrogliosis ameliorates pathology in an Alzheimer's disease model[J]. EMBO Mol Med, 2019, 11(2): e9665.
15	MEHLA J, SINGH I, DIWAN D, et al. STAT3 inhibitor mitigates cerebral amyloid angiopathy and parenchymal amyloid plaques while improving cognitive functions and brain networks[J]. Acta Neuropathol Commun, 2021, 9(1): 193.
16	ZOU J, SHANG W L, YANG L, et al. Microglia activation in the mPFC mediates anxiety-like behaviors caused by Staphylococcus aureus strain USA300[J]. Brain Behav, 2022, 12(9): e2715.
17	HU Y, LI H X, ZHANG J, et al. Periodontitis induced by P. gingivalis-LPS is associated with neuroinflammation and learning and memory impairment in sprague-dawley rats[J]. Front Neurosci, 2020, 14: 658.
18	SHCHOLOK T, EFTEKHARPOUR E. Cre-recombinase systems for induction of neuron-specific knockout models: a guide for biomedical researchers[J]. Neural Regen Res, 2023, 18(2): 273-279.
19	JIA X N, GAO Z H, HU H L. Microglia in depression: current perspectives[J]. Sci China Life Sci, 2021, 64(6): 911-925.

[1]	WANG Dayuan, XU Jianrong, JIANG Gan, SONG Qingxiang, CHEN Jun, SONG Huahua, GU Xiao, GAO Xiaoling. Effect of α-mangostin on amyotrophic lateral sclerosis and its mechanism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1265-1274.
[2]	GE Yiqin, HUANG Yuji, LI Weize, LI Yanning, LI Li. Effect of intragastric treatment of sodium cromoglycate on dextran sulfate sodium-induced ulcerative colitis in BALB/c mice [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(10): 1375-1382.
[3]	LIU Ming-dong, LIU Xiao-bo, ZHAO Ying-jie, ZHANG Yan, ZHANG Hui-hui, LI Fu-bin. Establishment and validation of OX40/FcγR-humanized mice for the study of agonistic anti-OX40 antibody [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(6): 728-735.
[4]	YANG Meng, LU Hong-li, HUANG Xu, XU Wen-xie. Inhibition of resveratrol on colonic movement in mice and its mechanism [J]. , 2020, 40(2): 180-.
[5]	WANG Hong-mei,FU Jian-liang,ZHANG Ting,CHEN Jing-jiong,ZHAO Yu-wu. Inhibition of genistein against LPS-induced proinflammatory response in microglia [J]. , 2019, 39(5): 446-.
[6]	QIN Qian1, LI Tong2, YOU Jian-peng3, Lü Chao1, ZHANG Li-juan1, ZHANG Man2. Rat model construction and evaluation of pelvic inflammatory disease [J]. , 2019, 39(10): 1218-.
[7]	MAO Rui-zhi1, 2, ZHANG Chen1, 2, FANG Yi-ru1, 2. Research progress of microglia and peripheral monocytes in mood disorders [J]. , 2018, 38(5): 552-.
[8]	HU Fan, NIU Yi-xin, TU Xiao-fang, SU Qing, ZHANG Hong-mei. Resistant dextrin improves insulin resistance in db/db miceenhancing insulin signaling pathway [J]. , 2018, 38(10): 1157-.
[9]	HAN Shuo, Lü Tao, ZHANG Xiao-hua . Activation mechanism and therapeutic use of microglia in subarachnoid hemorrhage#br# [J]. , 2017, 37(8): 1169-.
[10]	ZHI Nan, XU Qun . Effects of d1-3-n-butylphthalide on the release of inflammatory mediators in lipopolysaccharide-activated microglia cells [J]. , 2016, 36(12): 1719-.
[11]	LI Jia-jia, LI Yong-hua, GONG Hai-qing, et al. Application of multi-channel in vivo recording techniques to amygdala-kindling epilepsy mice [J]. , 2015, 35(8): 1108-.
[12]	QIAN Xiao-lan, WANG Qing-duan, ZHANG Wei, et al. Effects of dexmedetomidine on expressions of IL-1β and TNF-α in hippocampus tissues of aged mice after surgery [J]. , 2015, 35(2): 184-.
[13]	LI Yang, XIAO Li, GENG Ai-wen, et al. Experimental study on establishing mouse model of nonalcoholic steatohepatitis by different diet structures [J]. , 2015, 35(11): 1682-.
[14]	SUN Xi-ling, LI Chun-bo, XIE Bin, BIAN Qian. Effects and mechanisms of ziprasidone towards the activation of microglia [J]. , 2015, 35(10): 1431-.
[15]	TANG Shuang-qi, YIN Sha, LU Yang. Synthesis of N-stearyl tyrosine salts and measurement of its critical micelle concentration [J]. , 2014, 34(6): 794-.