Analysis of transcriptome and chromatin accessibility changes during the differentiation of human embryonic stem cells into neural progenitor cells

doi:10.3969/j.issn.1674-8115.2025.04.001

Abstract

Abstract:

Objective ·To investigate the changes in transcriptome and chromatin accessibility during the differentiation of human embryonic stem cells (hESCs) into neural progenitor cells (NPCs) using in vitro differentiation models and high-throughput multi-omics sequencing technologies. Methods ·hESCs were first induced to differentiate into NPCs in vitro using the embryoid body formation method, and cells at both stages were collected. The cell phenotypes were identified by reverse transcription-quantitative real-time PCR (RT-qPCR) and immunofluorescence (IF) staining. Transcriptome sequencing (RNA-seq) was conducted to detect and analyze the differentially expressed genes (DEGs) between hESCs and NPCs. The assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) was employed to assess chromatin accessibility changes between hESCs and NPCs. Motif enrichment analysis was performed on differentially accessible chromatin regions to discover potential regulatory transcription factors. Finally, an integrated analysis of RNA-seq and ATAC-seq data and the protein-protein interaction (PPI) network were performed to identify key genes and regulatory pathways involved in the early stages of neural differentiation in vitro. Results ·Both RT-qPCR and IF results indicated that the expression levels of pluripotency markers (NANOG and POU5F1) were high at the hESC stage but significantly decreased at the NPC stage, while early neural differentiation markers (PAX6, SOX1, and NES) were minimally expressed at the hESC stage but markedly upregulated at the NPC stage. RNA-seq analysis revealed that compared to the hESC stage, there were 5 597 genes upregulated and 3 654 genes downregulated at the NPC stage. Gene function enrichment analysis showed that the upregulated genes at the NPC stage were enriched in the functions related to neural development. ATAC-seq analysis demonstrated a total of 27 491 genomic regions had significant changes in chromatin accessibility during the differentiation from hESC to NPC, with 12 381 regions showing increased accessibility and 15 110 regions showing decreased accessibility. Motif enrichment analysis revealed that transcription factor genes such as DLX1 and LHX2 might play an important role in the differentiation process from hESCs into NPCs. Integrated analysis of RNA-seq and ATAC-seq data revealed that overlapping genes with high expression at the NPC stage were mainly enriched in axon guidance, forebrain development, and neuron migration. After neural differentiation, the expression levels of CTNND2 and LHX2 genes increased, and the chromatin accessibility of related genomic regions also increased. PPI network analysis indentified candidate downstream genes including PRKACA, CDH2, and ERBB4. Conclusion ·The in vitro differentiation model of hESCs combined with high-throughput multi-omics sequencing technologies can be used to depict the changes in transcriptome and chromatin accessibility during the differentiation of hESCs into NPCs. In this process, the expression levels of genes related to axon guidance, forebrain development, and neuronal migration pathways increase and related chromatin accessibility is enhanced.

Key words: human embryonic stem cell (hESC), neural progenitor cell (NPC), assay for transposase-accessible chromatin with sequencing (ATAC-Seq), RNA sequencing (RNA-seq)

CLC Number:

R321.5

LI Linying, CAI Xiaodong, TONG Ran, YANG Chen, WANG Zhiming, HE Xiaoyu, MA Ziyue, ZHANG Feng, LI Lingjie, ZHOU Junmei. Analysis of transcriptome and chromatin accessibility changes during the differentiation of human embryonic stem cells into neural progenitor cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(4): 387-403.

Figures/Tables 11

TrendMD

References 57

1	UCHIDA N, BUCK D W, HE D, et al. Direct isolation of human central nervous system stem cells[J]. Proc Natl Acad Sci USA, 2000, 97(26): 14720-14725.
2	NOCTOR S C, FLINT A C, WEISSMAN T A, et al. Neurons derived from radial glial cells establish radial units in neocortex[J]. Nature, 2001, 409(6821): 714-720.
3	KRIEGSTEIN A, ALVAREZ-BUYLLA A. The glial nature of embryonic and adult neural stem cells[J]. Annu Rev Neurosci, 2009, 32: 149-184.
4	MARCHETTO M C, BELINSON H, TIAN Y, et al. Altered proliferation and networks in neural cells derived from idiopathic autistic individuals[J]. Mol Psychiatry, 2017, 22(6): 820-835.
5	HOWELL B W, SMITH K M. Synaptic structural protein dysfunction leads to altered excitation inhibition ratios in models of autism spectrum disorder[J]. Pharmacol Res, 2019, 139: 207-214.
6	BOZZI Y, PROVENZANO G, CASAROSA S. Neurobiological bases of autism-epilepsy comorbidity: a focus on excitation/inhibition imbalance[J]. Eur J Neurosci, 2018, 47(6): 534-548.
7	OLIVEIRA B, MITJANS M, NITSCHE M A, et al. Excitation-inhibition dysbalance as predictor of autistic phenotypes[J]. J Psychiatr Res, 2018, 104: 96-99.
8	MOOSAVI A, MOTEVALIZADEH ARDEKANI A. Role of epigenetics in biology and human diseases[J]. Iran Biomed J, 2016, 20(5): 246-258.
9	FITZ-JAMES M H, CAVALLI G. Molecular mechanisms of transgenerational epigenetic inheritance[J]. Nat Rev Genet, 2022, 23(6): 325-341.
10	ALLIS C D, JENUWEIN T. The molecular hallmarks of epigenetic control[J]. Nat Rev Genet, 2016, 17(8): 487-500.
11	DAI S K, LIU P P, LI X, et al. Dynamic profiling and functional interpretation of histone lysine crotonylation and lactylation during neural development[J]. Development, 2022, 149(14): dev200049.
12	SUN T Y, XU Y Y, XIANG Y, et al. Crosstalk between RNA m⁶A and DNA methylation regulates transposable element chromatin activation and cell fate in human pluripotent stem cells[J]. Nat Genet, 2023, 55(8): 1324-1335.
13	WANG C F, YANG J W, ZHUANG Z H, et al. Activity-dependent feedback regulation of thalamocortical axon development by Lhx2 in cortical layer 4 neurons[J]. Cereb Cortex, 2023, 33(5): 1693-1707.
14	TSENG C J, MCDOUGLE C J, HOOKER J M, et al. Epigenetics of autism spectrum disorder: histone deacetylases[J]. Biol Psychiatry, 2022, 91(11): 922-933.
15	CONBOY K, HENSHALL D C, BRENNAN G P. Epigenetic principles underlying epileptogenesis and epilepsy syndromes[J]. Neurobiol Dis, 2021, 148: 105179.
16	KLEMM S L, SHIPONY Z, GREENLEAF W J. Chromatin accessibility and the regulatory epigenome[J]. Nat Rev Genet, 2019, 20(4): 207-220.
17	SONG L Y, CRAWFORD G E. [J]. Cold Spring Harb Protoc, 2010, 2010(2): pdb.prot5384.
18	BUENROSTRO J D, GIRESI P G, ZABA L C, et al. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position[J]. Nat Methods, 2013, 10(12): 1213-1218.
19	MARKENSCOFF-PAPADIMITRIOU E, WHALEN S, PRZYTYCKI P, et al. A chromatin accessibility atlas of the developing human telencephalon[J]. Cell, 2020, 182(3): 754-769.e18.
20	LU C Y, GARIPLER G, DAI C, et al. Essential transcription factors for induced neuron differentiation[J]. Nat Commun, 2023, 14(1): 8362.
21	THOMSON J A, ITSKOVITZ-ELDOR J, SHAPIRO S S, et al. Embryonic stem cell lines derived from human blastocysts[J]. Science, 1998, 282(5391): 1145-1147.
22	TAKAHASHI K, TANABE K, OHNUKI M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors[J]. Cell, 2007, 131(5): 861-872.
23	YU J Y, VODYANIK M A, SMUGA-OTTO K, et al. Induced pluripotent stem cell lines derived from human somatic cells[J]. Science, 2007, 318(5858): 1917-1920.
24	CHAMBERS S M, FASANO C A, PAPAPETROU E P, et al. Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling[J]. Nat Biotechnol, 2009, 27(3): 275-280.
25	KAWASAKI H, MIZUSEKI K, NISHIKAWA S, et al. Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity[J]. Neuron, 2000, 28(1): 31-40.
26	LEE H, SHAMY G A, ELKABETZ Y, et al. Directed differentiation and transplantation of human embryonic stem cell-derived motoneurons[J]. Stem Cells, 2007, 25(8): 1931-1939.
27	ZHANG S C, WERNIG M, DUNCAN I D, et al. In vitro differentiation of transplantable neural precursors from human embryonic stem cells[J]. Nat Biotechnol, 2001, 19(12): 1129-1133.
28	TCHIEU J, ZIMMER B, FATTAHI F, et al. A modular platform for differentiation of human PSCs into all major ectodermal lineages[J]. Cell Stem Cell, 2017, 21(3): 399-410.e7.
29	MARTIN M. Cutadapt removes adapter sequences from high-throughput sequencing reads[J]. EMBnet J, 2011, 17(1): 10-12.
30	BOLGER A M, LOHSE M, USADEL B. Trimmomatic: a flexible trimmer for Illumina sequence data[J]. Bioinformatics, 2014, 30(15): 2114-2120.
31	PATEL R K, JAIN M. NGS QC Toolkit: a toolkit for quality control of next generation sequencing data[J]. PLoS One, 2012, 7(2): e30619.
32	KIM D, LANGMEAD B, SALZBERG S L. HISAT: a fast spliced aligner with low memory requirements[J]. Nat Methods, 2015, 12(4): 357-360.
33	LIAO Y, SMYTH G K, SHI W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features[J]. Bioinformatics, 2014, 30(7): 923-930.
34	LOVE M I, HUBER W, ANDERS S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2[J]. Genome Biol, 2014, 15(12): 550.
35	YU G C, WANG L G, HAN Y Y, et al. clusterProfiler: an R package for comparing biological themes among gene clusters[J]. OMICS, 2012, 16(5): 284-287.
36	LANGMEAD B, SALZBERG S L. Fast gapped-read alignment with bowtie 2[J]. Nat Methods, 2012, 9(4): 357-359.
37	ZHANG Y, LIU T, MEYER C A, et al. Model-based analysis of ChIP-seq (MACS)[J]. Genome Biol, 2008, 9(9): R137.
38	BAILEY T L, BODEN M, BUSKE F A, et al. MEME SUITE: tools for motif discovery and searching[J]. Nucleic Acids Res, 2009, 37(Web Server issue): W202-W208.
39	ROSS-INNES C S, STARK R, TESCHENDORFF A E, et al. Differential oestrogen receptor binding is associated with clinical outcome in breast cancer[J]. Nature, 2012, 481(7381): 389-393.
40	WATANABE K, UENO M, KAMIYA D, et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells[J]. Nat Biotechnol, 2007, 25(6): 681-686.
41	ITSKOVITZ-ELDOR J, SCHULDINER M, KARSENTI D, et al. Differentiation of human embryonic stem cells into embryoid bodies compromising the three embryonic germ layers[J]. Mol Med, 2000, 6(2): 88-95.
42	SZKLARCZYK D, KIRSCH R, KOUTROULI M, et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest[J]. Nucleic Acids Res, 2023, 51(D1): D638-D646.
43	JIA E T, PAN M, LIU Z Y, et al. Transcriptomic profiling of differentially expressed genes and related pathways in different brain regions in Parkinson's disease[J]. Neurosci Lett, 2020, 732: 135074.
44	ARAYA C, HÄKKINEN H M, CARCAMO L, et al. Cdh2 coordinates Myosin-Ⅱ dependent internalisation of the zebrafish neural plate[J]. Sci Rep, 2019, 9(1): 1835.
45	BARETTINO C, BALLESTEROS-GONZALEZ Á, AYLÓN A, et al. Developmental disruption of Erbb4 in Pet1+ neurons impairs serotonergic sub-system connectivity and memory formation[J]. Front Cell Dev Biol, 2021, 9: 770458.
46	TUNCAY I O, PARMALEE N L, KHALIL R, et al. Analysis of recent shared ancestry in a familial cohort identifies coding and noncoding autism spectrum disorder variants[J]. NPJ Genom Med, 2022, 7(1): 13.
47	ASADOLLAHI R, ONEDA B, JOSET P, et al. The clinical significance of small copy number variants in neurodevelopmental disorders[J]. J Med Genet, 2014, 51(10): 677-688.
48	CHEN Z N, LI X J, CUI X Z, et al. Association of CTNND2 gene polymorphism with schizophrenia: two-sample case-control study in Chinese Han population[J]. Int J Psychiatry Med, 2023, 58(5): 433-448.
49	WANG L Y, XU M, WANG Y, et al. Melatonin improves synapse development by PI3K/Akt signaling in a mouse model of autism spectrum disorder[J]. Neural Regen Res, 2024, 19(7): 1618-1624.
50	VAZ R, EDWARDS S, DUEÑAS-REY A, et al. Loss of ctnnd2b affects neuronal differentiation and behavior in zebrafish[J]. Front Neurosci, 2023, 17: 1205653.
51	SCHMID C M, GREGOR A, COSTAIN G, et al. LHX2 haploinsufficiency causes a variable neurodevelopmental disorder[J]. Genet Med, 2023, 25(7): 100839.
52	WANG Y N, KHANDELWAL N, LIU S Q, et al. KDM6B cooperates with Tau and regulates synaptic plasticity and cognition via inducing VGLUT1/2[J]. Mol Psychiatry, 2022, 27(12): 5213-5226.
53	LI W, SHEN W C, ZHANG B, et al. Long non-coding RNA LncKdm2b regulates cortical neuronal differentiation by cis-activating Kdm2b[J]. Protein Cell, 2020, 11(3): 161-186.
54	CHEN D H, MCMANUS C E, RADMANESH B, et al. Temporal inhibition of chromatin looping and enhancer accessibility during neuronal remodeling[J]. Nat Commun, 2021, 12(1): 6366.
55	RAHMAN S, DONG P F, APONTES P, et al. Lineage specific 3D genome structure in the adult human brain and neurodevelopmental changes in the chromatin interactome[J]. Nucleic Acids Res, 2023, 51(20): 11142-11161.
56	CORCES M R, SHCHERBINA A, KUNDU S, et al. Single-cell epigenomic analyses implicate candidate causal variants at inherited risk loci for Alzheimer's and Parkinson's diseases[J]. Nat Genet, 2020, 52(11): 1158-1168.
57	PAGNI S, MILLS J D, FRANKISH A, et al. Non-coding regulatory elements: potential roles in disease and the case of epilepsy[J]. Neuropathol Appl Neurobiol, 2022, 48(3): e12775.

Gene	Forward (5'→3')	Reverse (5'→3')
GAPDH	CTGAGAACGGGAAGCTTGT	GGGTGCTAAGCAGTTGGT
NANOG	GAATGAAATCTAAGAGGTGGCA	CCTGGTGGTAGGAAGAGTAAAGG
POU5F1	ACATCAAAGCTCTGCAGAAAGAACT	CTGAATACCTTCCCAAATAGAACCC
SOX1	GGAATGGGAGGACAGGATTT	ACTTTTATTTCTCGGCCCGT
PAX6	GCCTATGCAACCCCCAGT	TCACTTCCGGGAACTTGAAC
NES	TGCGGGCTACTGAAAAGTTC	AGGCTGAGGGACATCTTGAG

Gene	Forward (5'→3')	Reverse (5'→3')
GAPDH	CTGAGAACGGGAAGCTTGT	GGGTGCTAAGCAGTTGGT
NANOG	GAATGAAATCTAAGAGGTGGCA	CCTGGTGGTAGGAAGAGTAAAGG
POU5F1	ACATCAAAGCTCTGCAGAAAGAACT	CTGAATACCTTCCCAAATAGAACCC
SOX1	GGAATGGGAGGACAGGATTT	ACTTTTATTTCTCGGCCCGT
PAX6	GCCTATGCAACCCCCAGT	TCACTTCCGGGAACTTGAAC
NES	TGCGGGCTACTGAAAAGTTC	AGGCTGAGGGACATCTTGAG

Index	Sample
Index	ESC_S1	ESC_S2	NPC_S1	NPC_S2
Total raw read pairs/n	45 792 974	53 251 136	50 419 620	52 973 024
Total raw bases/n	6 914 739 074	8 040 921 536	7 613 362 620	7 998 926 624
Mapped reads/n	44 506 927	51 742 966	48 948 795	51 574 332
Mapped ratio/%	97.95	97.92	97.87	98.13
High-quality mapped reads/n	43 139 843	50 148 322	47 576 740	50 093 517
High-quality mapped ratio/%	94.94	94.90	95.13	95.31

Index	Sample
Index	ESC_S1	ESC_S2	NPC_S1	NPC_S2
Total raw read pairs/n	45 792 974	53 251 136	50 419 620	52 973 024
Total raw bases/n	6 914 739 074	8 040 921 536	7 613 362 620	7 998 926 624
Mapped reads/n	44 506 927	51 742 966	48 948 795	51 574 332
Mapped ratio/%	97.95	97.92	97.87	98.13
High-quality mapped reads/n	43 139 843	50 148 322	47 576 740	50 093 517
High-quality mapped ratio/%	94.94	94.90	95.13	95.31

Index	Sample
Index	ESC_S1	ESC_S2	NPC_S1	NPC_S2
Total raw read pairs/n	63 713 180	32 001 236	88 523 604	61 924 682
Total raw bases/n	9 620 690 180	4 832 186 636	13 367 000 000	9 350 626 982
Mapped read pairs/n	61 240 240	30 684 142	84 944 932	59 439 388
Mapped ratio/%	98.36	98.52	98.24	97.98
High-quality mapped read pairs/n	54 624 252	27 152 448	75 936 202	53 201 562
High-quality mapped ratio/%	87.73	87.18	87.82	87.70
Percent duplication/%	23.70	20.59	22.18	29.05
Non-duplicate read pairs/n	41 677 046	21 562 952	59 092 184	37 745 230