Comparison of DNA and RNA extraction efficiency from blood

doi:10.3969/j.issn.1674-8115.2025.04.010

Abstract

Abstract:

Objective ·To comprehensively evaluate the efficiency of different kits and methods for DNA and RNA extraction from blood samples. Methods ·A total of 145 blood samples were collected, including those from patients with Alzheimer's disease (20 cases), fibrosis (5 cases), colorectal cancer (108 cases), and healthy individuals (12 cases). A column-based kit (Kit A) and a nucleic acid extraction instrument were used to extract genomic DNA (gDNA) from leukocytes in the blood. Cell-free DNA (cfDNA) and cell-free RNA (cfRNA) in plasma were extracted using five different kits (Kit B‒F), which employed either column-based (Kit B, E) or magnetic bead-based methods (Kit C, D, F). The extraction process of Kit B was optimized by increasing the plasma sample volume and extending the elution incubation time. Furthermore, this protocol was applied to extracting cfDNA from plasma samples of 100 colorectal cancer patients. Quantitative real-time PCR (qPCR) was used to quantify the extracted DNA and RNA, and the molecular yields were compared to evaluate the extraction efficiency. A comprehensive assessment was conducted, considering factors such as cost and operation time. Results ·In gDNA extraction, although the the operation time was shortened by using the nucleic acid extraction instrument, the median number of DNA molecules extracted using Kit A (column-based method) was 25.36-fold higher than that obtained with the instrument (P<0.05). For cfDNA extraction, while the overall efficiency of the three kits (Kit B‒D) was similar, Kit B (column-based method) showed superior performance in low-concentration samples, with average DNA yields 4.24-fold and 1.18-fold higher than those of Kit D and Kit C (both magnetic bead-based). Optimization of Kit B's extraction protocol further improved cfDNA yield. When comparing three samples, the cfDNA yields from larger plasma input volumes was 3.98-fold, 2.38-fold, and 3.82-fold higher than those from smaller input volumes, respectively. The results of cfDNA extraction from 100 colorectal cancer patients indicated that this extraction protocol reliably extracted sufficient amounts of cfDNA from clinical samples. For cfRNA extraction, Kit E (column-based method) was widely recommended due to its high efficiency, convenience, and cost-effectiveness. The median RNA content extracted using Kit E was 5.01-fold higher than that of Kit F (magnetic bead-based method). Lastly, a comparison of the copy numbers of cfDNA and cfRNA in plasma revealed that the average copy number of cfRNA per milliliter of plasma was 27.65-fold higher than that of cfDNA. Conclusion ·Kit A, Kit B, and Kit E show outstanding performance in leukocyte gDNA extraction, plasma cfDNA extraction, and plasma cfRNA extraction, respectively. However, although Kit E has advantages in extraction efficiency and cost, its safety requires further evaluation.

Key words: nucleicacid extraction, plasma cell-free DNA (cfDNA), plasma cell-free RNA (cfRNA), extraction kit, quantitative real-time PCR (qPCR)

CLC Number:

R446.1

SU Xinglei, LU Ping, PENG Junjie, WANG Zimin, SONG Ping, HAN Da. Comparison of DNA and RNA extraction efficiency from blood[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(4): 476-486.

Figures/Tables 11

TrendMD

References 28

1	ALIX-PANABIÈRES C, PANTEL K. Clinical applications of circulating tumor cells and circulating tumor DNA as liquid biopsy[J]. Cancer Discov, 2016, 6(5): 479-491.
2	DOMÍNGUEZ-VIGIL I G, MORENO-MARTÍNEZ A K, WANG J Y, et al. The dawn of the liquid biopsy in the fight against cancer[J]. Oncotarget, 2018, 9(2): 2912-2922.
3	WANG Z, QIN H, LIU S, et al. Precision diagnosis of hepatocellular carcinoma[J]. Chin Med J (Engl), 2023, 136(10): 1155-1165.
4	MARTIN-ALONSO C, TABRIZI S, XIONG K, et al. Priming agents transiently reduce the clearance of cell-free DNA to improve liquid biopsies[J]. Science, 2024, 383(6680): eadf2341.
5	ABBOSH C, BIRKBAK N J, WILSON G A, et al. Phylogenetic ctDNA analysis depicts early-stage lung cancer evolution[J]. Nature, 2017, 545(7655): 446-451.
6	BATOOL S M, YEKULA A, KHANNA P, et al. The liquid biopsy consortium: challenges and opportunities for early cancer detection and monitoring[J]. Cell Rep Med, 2023, 4(10): 101198.
7	TIVEY A, CHURCH M, ROTHWELL D, et al. Circulating tumour DNA: looking beyond the blood[J]. Nat Rev Clin Oncol, 2022, 19(9): 600-612.
8	VAN DER POL Y, MOULIERE F. Toward the early detection of cancer by decoding the epigenetic and environmental fingerprints of cell-free DNA[J]. Cancer Cell, 2019, 36(4): 350-368.
9	SHEN S Y, SINGHANIA R, FEHRINGER G, et al. Sensitive tumour detection and classification using plasma cell-free DNA methylomes[J]. Nature, 2018, 563(7732): 579-583.
10	NEWMAN A M, BRATMAN S V, TO J, et al. An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage[J]. Nat Med, 2014, 20(5): 548-554.
11	ALBITAR M, ZHANG H, CHARIFA A, et al. Combining cell-free RNA with cell-free DNA in liquid biopsy for hematologic and solid tumors[J]. Heliyon, 2023, 9(5): e16261.
12	ZHOU J, YU L, GAO X, et al. Plasma microRNA panel to diagnose hepatitis B virus-related hepatocellular carcinoma[J]. J Clin Oncol, 2011, 29(36): 4781-4788.
13	WANG S M, ZHANG K, TAN S Y, et al. Circular RNAs in body fluids as cancer biomarkers: the new frontier of liquid biopsies[J]. Mol Cancer, 2021, 20(1): 13.
14	LARSON M H, PAN W Y, KIM H J, et al. A comprehensive characterization of the cell-free transcriptome reveals tissue- and subtype-specific biomarkers for cancer detection[J]. Nat Commun, 2021, 12(1): 2357.
15	ALIX-PANABIÈRES C, PANTEL K. Liquid biopsy: from discovery to clinical application[J]. Cancer Discov, 2021, 11(4): 858-873.
16	LU J L, LIANG Z Y. Circulating free DNA in the era of precision oncology: pre- and post-analytical concerns[J]. Chronic Dis Transl Med, 2016, 2(4): 223-230.
17	SONG P, WU L R, YAN Y H, et al. Limitations and opportunities of technologies for the analysis of cell-free DNA in cancer diagnostics[J]. Nat Biomed Eng, 2022, 6(3): 232-245.
18	WANG J, HUANG J Y, HU Y L, et al. Terminal modifications independent cell-free RNA sequencing enables sensitive early cancer detection and classification[J]. Nat Commun, 2024, 15(1): 156.
19	RODDA A E, PARKER B J, SPENCER A, et al. Extending circulating tumor DNA analysis to ultralow abundance mutations: techniques and challenges[J]. ACS Sens, 2018, 3(3): 540-560.
20	GORMALLY E, CABOUX E, VINEIS P, et al. Circulating free DNA in plasma or serum as biomarker of carcinogenesis: practical aspects and biological significance[J]. Mutat Res, 2007, 635(2/3): 105-117.
21	FLEISCHHACKER M, SCHMIDT B. Circulating nucleic acids (CNAs) and cancer: a survey[J]. Biochim Biophys Acta, 2007, 1775(1): 181-232.
22	RISBERG B, TSUI D W Y, BIGGS H, et al. Effects of collection and processing procedures on plasma circulating cell-free DNA from cancer patients[J]. J Mol Diagn, 2018, 20(6): 883-892.
23	ZHU D, WANG H, WU W, et al. Circulating cell-free DNA fragmentation is a stepwise and conserved process linked to apoptosis[J]. BMC Biol, 2023, 21 (1): 253.
24	CHEN S, JIN Y, WANG S, et al. Cancer type classification using plasma cell-free RNAs derived from human and microbes[J]. Elife, 2022, 11, :e75181.
25	TAO Y H, XING S Z, ZUO S, et al. Cell-free multi-omics analysis reveals potential biomarkers in gastrointestinal cancer patients' blood[J]. Cell Rep Med, 2023, 4(11): 101281.
26	DENNIS LO Y M, HAN D S C, JIANG P Y, et al. Epigenetics, fragmentomics, and topology of cell-free DNA in liquid biopsies[J]. Science, 2021, 372(6538): eaaw3616.
27	CHANG A, LOY C J, EWEIS-LABOLLE D, et al. Circulating cell-free RNA in blood as a host response biomarker for detection of tuberculosis[J]. Nat Commun, 2024, 15(1): 4949.
28	RAEZ L E, DANENBERG K, SUMARRIVA D, et al. Using cfRNA as a tool to evaluate clinical treatment outcomes in patients with metastatic lung cancers and other tumors[J]. Cancer Drug Resist, 2021, 4(4): 1061-1071.

Name	Forward (5'→3')	Reverse (5'→3')
Amplicon 1	GCTCTTCCTCTCACATCTTTATTTAACC	TCCACACTGCAGTGTGAACAG
Amplicon 2	GCTCTTCCTCTCACATCTTTATTTAACC	AGAAGTAATCAGATTCTGGAAGAGCTG
Amplicon 3	GAAGGTGAAGGTCGGACAAC	CGAGTTAAAAGCAGCCTGGT

Name	Forward (5'→3')	Reverse (5'→3')
Amplicon 1	GCTCTTCCTCTCACATCTTTATTTAACC	TCCACACTGCAGTGTGAACAG
Amplicon 2	GCTCTTCCTCTCACATCTTTATTTAACC	AGAAGTAATCAGATTCTGGAAGAGCTG
Amplicon 3	GAAGGTGAAGGTCGGACAAC	CGAGTTAAAAGCAGCCTGGT

Name	Extraction method	Time-consumin/min	Sample type	Applicable volume/μL	Elution volume/μL	Indicative price for each reaction/yuan
Kit B	Adsorption column	60	Plasma, serum, and cell-free body fluid	100‒200	50‒100	60
Kit C	Magnetic bead	70	Serum, plasma, and cell-free body fluid	200‒2 000	30‒50	30
Kit D	Magnetic bead	50	Plasma, serum, urine, pleural fluid, cerebrospinal fluid, and saliva	100‒5 000	50‒100	30

Name	Extraction method	Time-consumin/min	Sample type	Applicable volume/μL	Elution volume/μL	Indicative price for each reaction/yuan
Kit B	Adsorption column	60	Plasma, serum, and cell-free body fluid	100‒200	50‒100	60
Kit C	Magnetic bead	70	Serum, plasma, and cell-free body fluid	200‒2 000	30‒50	30
Kit D	Magnetic bead	50	Plasma, serum, urine, pleural fluid, cerebrospinal fluid, and saliva	100‒5 000	50‒100	30

[1]	SUN Yameng, MA Ye, GUO Runsheng. Detection and analysis of copy number of HER2 gene in breast cancer tissue samples [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(11): 1589-1597.
[2]	SANG Chao, LIANG Dan-dan, XIE Guo-xiang, JIA Wei, CHEN Tian-lu. Progress in serological noninvasive diagnostic methods for non-alcoholic fatty liver disease [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 0, (): 0-.
[3]	XU Shu-lin, WU Jing, LOU Jia-tao. Correlation analysis of lung cancer and anemia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(11): 1500-1504.
[4]	ZOU Chen1, 2, XU Run-hao1, 3, ZHANG Hong2, MA Zhan2, CHEN Li2, ZHANG Jie3, LI Min3, ZHANG Shu-lin1. Potential roles of small metabolites in the differential diagnosis between lung cancer and pneumonia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(8): 1041-1047.