Structural insights into the recognition of endogenous nucleosomes by the human SUV39H1- HP1α complex

doi:10.3969/j.issn.1674-8115.2026.06.005

Abstract

Abstract:

Objective ·To analyze the three-dimensional structure of the human histone methyltransferase SUV39H1 in complex with heterochromatin protein 1α bound to the endogenous nucleosome core particle (NCP^endo) through cryo-electron microscopy (cryo-EM). Methods ·The human SUV39H1 gene was cloned into the pMLink vector with an N-terminal 6×His-3×Flag tag, and the human HP1α gene was cloned into the pMLink vector with an N-terminal 2×HA tag. The SUV39H1-HP1α complex was co-expressed in Expi293F mammalian suspension cells through transient transfection using polyethylenimine. The expressed complex was sequentially purified by affinity chromatography with anti-DYKDDDDK resin and glycerol gradient ultracentrifugation combined with chemical cross-linking. Subsequently, cryo-EM data collection and single-particle reconstruction were performed to obtain the three-dimensional electron density map of the SUV39H1-HP1α-NCP^endo complex. AlphaFold2-predicted models were docked into the EM density using UCSF Chimera. Results ·The SUV39H1-HP1α-NCP^endo complex was successfully obtained with high purity by affinity chromatography and glycerol density gradient ultracentrifugation. Cryo-EM single-particle reconstruction yielded a preliminary density map of the SUV39H1-HP1α-NCP^endo complex at a resolution of approximately 3.6 Å (1 Å=10^-10 m). In addition to the nucleosome core particle, an extra discontinuous peripheral density was observed. Based on its size and spatial distribution, preliminary structural fitting suggested that this density may correspond to the SET domain of SUV39H1. Conclusion ·The density map of the SUV39H1-HP1α-NCP^endo complex was obtained by cryo-EM and single-particle reconstruction. Although the peripheral density is discontinuous and does not support reliable atomic modeling, its size and spatial features are consistent with the SET domain (including pre-SET, SET, and post-SET sub-modules) of SUV39H1. In addition, the chromo domain (CD) of SUV39H1 and HP1α were not been clearly resolved, suggesting that these regions may exhibit conformational dynamics within this complex.

Key words: SUV39H1 methyltransferase, heterochromatin protein 1α (HP1α), nucleosome, epigenetic regulation, cryo-electron microscopy

CLC Number:

Q518.2

Hu Qiong, Huang Jing. Structural insights into the recognition of endogenous nucleosomes by the human SUV39H1- HP1α complex[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(6): 732-739.

Figures/Tables 7

TrendMD

References 20

[1]	Padeken J, Methot S P, Gasser S M. Establishment of H3K9-methylated heterochromatin and its functions in tissue differentiation and maintenance[J]. Nat Rev Mol Cell Biol, 2022, 23(9): 623-640.
[2]	Nicetto D, Zaret K S. Role of H3K9me3 heterochromatin in cell identity establishment and maintenance[J]. Curr Opin Genet Dev, 2019, 55: 1-10.
[3]	Elgin S C, Reuter G. Position-effect variegation, heterochromatin formation, and gene silencing in Drosophila[J]. Cold Spring Harb Perspect Biol, 2013, 5(8): a017780.
[4]	Saksouk N, Simboeck E, Dejardin J. Constitutive heterochromatin formation and transcription in mammals[J]. Epigenetics Chromatin, 2015, 8: 3.
[5]	Weirich S, Khella M S, Jeltsch A. Structure, activity and function of the SUV39H1 and SUV39H2 protein lysine methyltransferases[J]. Life, 2021, 11(7): 703.
[6]	Rea S, Eisenhaber F, O'Carroll D, et al. Regulation of chromatin structure by site-specific histone H3 methyltransferases[J]. Nature, 2000, 406(6796): 593-599.
[7]	Wang T, Xu C, Liu Y L, et al. Crystal structure of the human SUV39H1 chromodomain and its recognition of histone H3K9me2/3[J]. PLoS One, 2012, 7(12): e52977.
[8]	Müller M M, Fierz B, Bittova L, et al. A two-state activation mechanism controls the histone methyltransferase Suv39h1[J]. Nat Chem Biol, 2016, 12(3): 188-193.
[9]	Bannister A J, Zegerman P, Partridge J F, et al. Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain[J]. Nature, 2001, 410(6824): 120-124.
[10]	Sokolova V, Miratsky J, Svetlov V, et al. Structural mechanism of HP1α-dependent transcriptional repression and chromatin compaction[J]. bioRxiv, 2023: 2023.11.30.569387.
[11]	Canzio D, Liao M F, Naber N, et al. A conformational switch in HP1 releases auto-inhibition to drive heterochromatin assembly[J]. Nature, 2013, 496(7445): 377-381.
[12]	Fischer T, Cui B W, Dhakshnamoorthy J, et al. Diverse roles of HP1 proteins in heterochromatin assembly and functions in fission yeast[J]. Proc Natl Acad Sci USA, 2009, 106(22): 8998-9003.
[13]	Motamedi M R, Hong E J, Li X, et al. HP1 proteins form distinct complexes and mediate heterochromatic gene silencing by nonoverlapping mechanisms[J]. Mol Cell, 2008, 32(6): 778-790.
[14]	Nishibuchi G, Nakayama J. Biochemical and structural properties of heterochromatin protein 1: understanding its role in chromatin assembly[J]. J Biochem, 2014, 156(1): 11-20.
[15]	Zhang K, Mosch K, Fischle W, et al. Roles of the Clr4 methyltransferase complex in nucleation, spreading and maintenance of heterochromatin[J]. Nat Struct Mol Biol, 2008, 15(4): 381-388.
[16]	Allshire R C, Madhani H D. Ten principles of heterochromatin formation and function[J]. Nat Rev Mol Cell Biol, 2018, 19(4): 229-244.
[17]	Nakayama J, Rice J C, Strahl B D, et al. Role of histone H3 lysine 9 methylation in epigenetic control of heterochromatin assembly[J]. Science, 2001, 292(5514): 110-113.
[18]	Canzio D, Chang E Y, Shankar S, et al. Chromodomain-mediated oligomerization of HP1 suggests a nucleosome-bridging mechanism for heterochromatin assembly[J]. Mol Cell, 2011, 41(1): 67-81.
[19]	Ragunathan K, Jih G, Moazed D. Epigenetics. Epigenetic inheritance uncoupled from sequence-specific recruitment[J]. Science, 2015, 348(6230): 1258699.
[20]	Akoury E, Ma G L, Demolin S, et al. Disordered region of H3K9 methyltransferase Clr4 binds the nucleosome and contributes to its activity[J]. Nucleic Acids Res, 2019, 47(13): 6726-6736.

Gene	Forward primer sequence	Reverse primer sequence
SUV39H1	CGCGGATCCATGGCGGAAATTTAAAAGGCTGCAGCG	CCGCTCGAGCTAGAAGAGGTATTTGCGGCAGGACTCAGTCC
HP1α	CGCGGATCCATGGGAAAGAAAACCAAGCGGACAGC	CCGCTCGAGTTAGCTCTTTGCTGTTTCTTTCTCTTTGTTTTCC

Gene	Forward primer sequence	Reverse primer sequence
SUV39H1	CGCGGATCCATGGCGGAAATTTAAAAGGCTGCAGCG	CCGCTCGAGCTAGAAGAGGTATTTGCGGCAGGACTCAGTCC
HP1α	CGCGGATCCATGGGAAAGAAAACCAAGCGGACAGC	CCGCTCGAGTTAGCTCTTTGCTGTTTCTTTCTCTTTGTTTTCC

Protein	Gene name	PSM	Unique peptide
Histone-lysine N-methyltransferase SUV39H1	SUV39H1	118	33
Chromobox protein homolog 5	HP1α	115	15
Histone H4	H4C9	107	18
Histone H2B type 1-K	H2BC12	62	5
Histone H2B type 1-J	H2BC11	59	1
Histone H2B type 3-B	H2BC26	55	2
Histone H2A type 1-B/E	H2AC8	33	2
Histone H2A type 1	H2AC17	33	1
Histone H3.1	H3C12	28	5

Protein	Gene name	PSM	Unique peptide
Histone-lysine N-methyltransferase SUV39H1	SUV39H1	118	33
Chromobox protein homolog 5	HP1α	115	15
Histone H4	H4C9	107	18
Histone H2B type 1-K	H2BC12	62	5
Histone H2B type 1-J	H2BC11	59	1
Histone H2B type 3-B	H2BC26	55	2
Histone H2A type 1-B/E	H2AC8	33	2
Histone H2A type 1	H2AC17	33	1
Histone H3.1	H3C12	28	5

Data collection and processing	SUV39H1-HP1α-NCP^endo complex
Magnification	81 000
Voltage /kV	300
Electron exposure/(e^-·Å^-2)	50.0
Defocus range/μm	-0.8‒-2.5
Pixel size /Å	1.1
Symmetry imposed	C1
Initial particle images/n	5 295 046
Final particle images /n	2 167 181
Map resolution/Å (FSC threshold 0.143)	3.6
Map resolution range/Å	2.5‒7.5