Preliminary study on early warning value and mechanism of interleukin-1β in extremely severe oral and maxillofacial space infections

doi:10.3969/j.issn.1674-8115.2025.06.001

Abstract

Abstract:

Objective ·To investigate the role of interleukin-1β (IL-1β) in predicting the severity of oral and maxillofacial space infection (OMSI), and to explore the key mechanisms regulating IL-1β release, the critical immune cell subpopulations involved, and the intercellular communication networks among immune cells in OMSI patients. Methods ·A total of 62 OMSI patients admitted to the Department of Oral Surgery, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, from January to November 2023 were enrolled, including 20 patients with moderate infection, 21 with severe infection, and 21 with extremely severe infection. Logistic regression analysis was performed to identify risk factors for extremely severe infection, and receiver operating characteristic (ROC) curves were constructed to evaluate the ability of the above indicators to predict extremely severe infection. Peripheral blood mononuclear cells (PBMCs) from 2 patients in each group (moderate, severe and extremely severe) and 2 healthy controls (GSE224198) were analyzed using single-cell RNA sequencing (scRNA-seq) to identify key pro-inflammatory cell subtypes and genes, and to examine their changing trends with increasing infection severity. Cell-cell communication was assessed using CellChat. Quantitative real-time polymerase chain reaction (qPCR) and Western blotting were used to validate inflammasome activation levels in PBMCs. Results ·Compared with patients with moderate and severe infections, levels of procalcitonin (PCT) (P<0.05) and IL-1β (P<0.05) were significantly elevated in patients with extremely severe infection. Logistic regression identified IL-1β as an independent risk factor for extremely severe infection (OR=1.814, 95% CI 1.256‒2.621, P=0.002). The area under the ROC curve (AUC) for the combined prediction of extremely severe infection using IL-1β and PCT was 0.943. scRNA-seq revealed continuous upregulation of NLRP3 (NOD-like receptor family pyrin domain-containing 3) and IL1B gene expression in monocytes as infection severity increased, with intermediate monocytes being the main IL1B-expressing cell subtype. IL-1Β-IL-1R signaling, C-C motif chemokine ligand (CCL) and intercellular adhesion molecule (ICAM) signaling were significantly enhanced in monocytes. Macrophage migration inhibitory factor (MIF) signaling between T cells and monocytes also increased notably. With infection progression, the mRNA levels of NLRP3 and IL1B in peripheral blood rose steadily, and the protein levels of NLRP3, caspase-1 p20, apoptosis-associated speck-like protein containing a CARD (ASC) and IL-1β were persistently elevated. Conclusion ·The combined levels of IL-1β and PCT at admission can effectively predict extremely severe OMSI. NLRP3 inflammasome activation is observed in PBMCs of OMSI patients. The elevation of IL-1β is closely associated with intermediate monocytes. Monocyte-mediated IL-1Β-IL-1R, CCL and ICAM signaling pathways, along with T cell-mediated MIF signaling pathways, collectively promote the inflammatory response.

Key words: oral and maxillofacial space infection (OMSI), interleukin-1β (IL-1β), intermediate monocyte, single-cell RNA sequencing (scRNA-seq), cellular communication

CLC Number:

R782.3

ZHU Hanyi, SHI Huan, YU Chuangqi, ZHENG Lingyan. Preliminary study on early warning value and mechanism of interleukin-1β in extremely severe oral and maxillofacial space infections[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(6): 661-672.

Figures/Tables 11

TrendMD

References 32

[1]	MEISGEIER A, PIENKOHS S, DÜRRSCHNABEL F, et al. Rising incidence of severe maxillofacial space infections in Germany[J]. Clin Oral Investig, 2024, 28(5): 264.
[2]	ROBERTSON D D, SMITH A J. Significant increase in hospital admissions for the management of severe dental infection in England 2000-2020[J]. J Infect, 2021, 83(4): 496-522.
[3]	QIAN Y Z, GE Q, ZUO W, et al. Maxillofacial space infection experience and risk factors: a retrospective study of 222 cases[J]. Ir J Med Sci, 2021, 190(3): 1045-1053.
[4]	CARRASCOSA M F, CAYÓN HOYO S, ECHEVERRÍA SAN-SEBASTIÁN R, et al. Descending necrotizing mediastinitis from ludwig's angina: a life-threatening condition[J]. Eur J Clin Microbiol Infect Dis, 2022, 41(1): 181-183.
[5]	BULEK K, ZHAO J J, LIAO Y, et al. Epithelial-derived gasdermin D mediates nonlytic IL-1β release during experimental colitis[J]. J Clin Invest, 2020, 130(8): 4218-4234.
[6]	LI Y, JIANG Q Z. Uncoupled pyroptosis and IL-1β secretion downstream of inflammasome signaling[J]. Front Immunol, 2023, 14: 1128358.
[7]	YANG X Y, CHENG X Y, TANG Y T, et al. Bacterial endotoxin activates the coagulation cascade through gasdermin D-dependent phosphatidylserine exposure[J]. Immunity, 2019, 51(6): 983-996.e6.
[8]	BUSCH K, KNY M, HUANG N, et al. Inhibition of the NLRP3/IL-1β axis protects against sepsis-induced cardiomyopathy[J]. J Cachexia Sarcopenia Muscle, 2021, 12(6): 1653-1668.
[9]	VIGNERON C, PY B F, MONNERET G, et al. The double sides of NLRP3 inflammasome activation in sepsis[J]. Clin Sci (Lond), 2023, 137(5): 333-351.
[10]	WANG B L, ZHOU Q, QIAN W T, et al. The predictive value of laboratory tests in oro-maxillofacial infection of different severity[J]. Oral Dis, 2024, 30(3): 1695-1701.
[11]	HUANG L J, JIANG B, CAI X Y, et al. Multi-space infections in the head and neck: do underlying systemic diseases have a predictive role in life-threatening complications?[J]. J Oral Maxillofac Surg, 2015, 73(7): 1320.e1-1320.10.
[12]	LI X J, LIU H, GONG Z C, et al. The predictive value of interleukin-6 and neutrophil-lymphocyte ratio in patients with severe and extremely severe oral and maxillofacial space infections[J]. Biomed Res Int, 2021, 2021: 2615059.
[13]	KANG S J, KISHIMOTO T. Interplay between interleukin-6 signaling and the vascular endothelium in cytokine storms[J]. Exp Mol Med, 2021, 53(7): 1116-1123.
[14]	MILLS K H G. IL-17 and IL-17-producing cells in protection versus pathology[J]. Nat Rev Immunol, 2023, 23(1): 38-54.
[15]	PAIK S, KIM J K, SILWAL P, et al. An update on the regulatory mechanisms of NLRP3 inflammasome activation[J]. Cell Mol Immunol, 2021, 18(5): 1141-1160.
[16]	BARNETT K C, LI S R, LIANG K X, et al. A 360° view of the inflammasome: mechanisms of activation, cell death, and diseases[J]. Cell, 2023, 186(11): 2288-2312.
[17]	HATSCHER L, AMON L, HEGER L, et al. Inflammasomes in dendritic cells: friend or foe?[J]. Immunol Lett, 2021, 234: 16-32.
[18]	CUI J, OEHRL S, AHMAD F, et al. Detection of in vivo inflammasome activation for predicting sepsis mortality[J]. Front Immunol, 2021, 11: 613745.
[19]	CROS J, CAGNARD N, WOOLLARD K, et al. Human CD14dim monocytes patrol and sense nucleic acids and viruses via TLR7 and TLR8 receptors[J]. Immunity, 2010, 33(3): 375-386.
[20]	PATEL V K, WILLIAMS H, LI S C H, et al. Monocyte inflammatory profile is specific for individuals and associated with altered blood lipid levels[J]. Atherosclerosis, 2017, 263: 15-23.
[21]	WONG K L, YEAP W H, TAI J J Y, et al. The three human monocyte subsets: implications for health and disease[J]. Immunol Res, 2012, 53(1/2/3): 41-57.
[22]	WILLIAMS H, MACK C, BARAZ R, et al. Monocyte differentiation and heterogeneity: inter-subset and interindividual differences[J]. Int J Mol Sci, 2023, 24(10): 8757.
[23]	OŻAŃSKA A, SZYMCZAK D, RYBKA J. Pattern of human monocyte subpopulations in health and disease[J]. Scand J Immunol, 2020, 92(1): e12883.
[24]	KIM H K, GARCIA A B, SIU E, et al. Macrophage migration inhibitory factor regulates innate γδ T-cell responses via IL-17 expression[J]. FASEB J, 2019, 33(6): 6919-6932.
[25]	SUMAIYA K, LANGFORD D, NATARAJASEENIVASAN K, et al. Macrophage migration inhibitory factor (MIF): a multifaceted cytokine regulated by genetic and physiological strategies[J]. Pharmacol Ther, 2022, 233: 108024.
[26]	BOZZA F A, GOMES R N, JAPIASSÚ A M, et al. Macrophage migration inhibitory factor levels correlate with fatal outcome in sepsis[J]. Shock, 2004, 22(4): 309-313.
[27]	STIJLEMANS B, SCHOOVAERTS M, DE BAETSELIER P, et al. The role of MIF and IL-10 as molecular Yin-Yang in the modulation of the host immune microenvironment during infections: African trypanosome infections as a paradigm[J]. Front Immunol, 2022, 13: 865395.
[28]	蒋文, 石丁华, 何艳娟, 等. 降钙素原对脂多糖诱导的人脐静脉内皮细胞NLRP3和caspase-1表达的影响[J]. 中国当代儿科杂志, 2023, 25(5): 521-526.
	JIANG W, SHI D H, HE Y J, et al. Effect of procalcitonin on lipopolysaccharide-induced expression of nucleotide-binding oligomerization domain-like receptor protein 3 and caspase-1 in human umbilical vein endothelial cells[J]. Chin J Contemp Pediatr, 2023, 25(5): 521-526.
[29]	WEI Z Y, ZHAN X Y, DING K X, et al. Dihydrotanshinone Ⅰ specifically inhibits NLRP3 inflammasome activation and protects against septic shock in vivo[J]. Front Pharmacol, 2021, 12: 750815.
[30]	TANUSEPUTERO S A, LIN M T, YEH S L, et al. Intravenous arginine administration downregulates NLRP3 inflammasome activity and attenuates acute kidney injury in mice with polymicrobial sepsis[J]. Mediators Inflamm, 2020, 2020: 3201635.
[31]	WEI S S, XIAO Z J, HUANG J, et al. Disulfiram inhibits oxidative stress and NLRP3 inflammasome activation to prevent LPS-induced cardiac injury[J]. Int Immunopharmacol, 2022, 105: 108545.
[32]	SHI X Y, LI T, LIU Y T, et al. HSF1 protects sepsis-induced acute lung injury by inhibiting NLRP3 inflammasome activation[J]. Front Immunol, 2022, 13: 781003.

Gene	Forward (5′→3′)	Reverse (5′→3′)
NLRP3	CGTGAGTCCCATTAAGATGGAGT	CCCGACAGTGGATATAGAACAGA
NLRP1	GGCAGCACAGATCAACATGGA	CAGGTTTCTGGTGACCTTGAGGA
AIM2	TCAAGCTGAAATGAGTCCTGC	CTTGGGTCTCAAACGTGAAGG
CASP1	CCTTAATATGCAAGACTCTCAAGGA	TAAGCTGGGTTGTCCTGCACT
ASC	TGGATGCTCTGTACGGGAAG	CCAGGCTGGTGTGAAACTGAA
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG

Gene	Forward (5′→3′)	Reverse (5′→3′)
NLRP3	CGTGAGTCCCATTAAGATGGAGT	CCCGACAGTGGATATAGAACAGA
NLRP1	GGCAGCACAGATCAACATGGA	CAGGTTTCTGGTGACCTTGAGGA
AIM2	TCAAGCTGAAATGAGTCCTGC	CTTGGGTCTCAAACGTGAAGG
CASP1	CCTTAATATGCAAGACTCTCAAGGA	TAAGCTGGGTTGTCCTGCACT
ASC	TGGATGCTCTGTACGGGAAG	CCAGGCTGGTGTGAAACTGAA
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG

Item	Moderate (n=20)	Severe (n=21)	Extremely severe (n=21)	P value
WBC/(×10⁹·L^-1)	14.67±3.82	14.57±3.41	16.77±8.45	0.378
ANC/(×10⁹·L^-1)	12.25±3.86	11.45±3.42	14.36±8.59	0.251
CRP/(mg·L^-1)	57.30 (26.63, 130.99)	65.61 (27.37, 97.35)	100.29 (33.82, 166.23)	0.386
PCT/(ng·L^-1)	0.10 (0.10, 0.25)	0.10 (0.10, 0.46)	4.10 (1.70, 6.85)	<0.001
Serum glucose/(mmol·L^-1)	7.79±2.77	8.39±4.87	9.71±5.61	0.394
IL-1β/(pg·mL^-1)	3.94±1.92	5.42±2.73	17.04±14.68	<0.001

Item	Moderate (n=20)	Severe (n=21)	Extremely severe (n=21)	P value
WBC/(×10⁹·L^-1)	14.67±3.82	14.57±3.41	16.77±8.45	0.378
ANC/(×10⁹·L^-1)	12.25±3.86	11.45±3.42	14.36±8.59	0.251
CRP/(mg·L^-1)	57.30 (26.63, 130.99)	65.61 (27.37, 97.35)	100.29 (33.82, 166.23)	0.386
PCT/(ng·L^-1)	0.10 (0.10, 0.25)	0.10 (0.10, 0.46)	4.10 (1.70, 6.85)	<0.001
Serum glucose/(mmol·L^-1)	7.79±2.77	8.39±4.87	9.71±5.61	0.394
IL-1β/(pg·mL^-1)	3.94±1.92	5.42±2.73	17.04±14.68	<0.001

Variable	β	SE	OR (95% CI)	Wald test	P value
IL-1β	0.596	0.188	1.814 (1.256‒2.621)	10.068	0.002
PCT	0.085	0.099	1.089 (0.897‒1.322)	0.744	0.388