RBX1 regulates uveal melanoma immune-related genes via STAT1

doi:10.3969/j.issn.1674-8115.2023.06.007

Abstract

Abstract:

Objective ·To investigate the role of RBX1 (ring-box protein 1) in the regulation of immune-related genes in uveal melanoma (UVM) tumor cells. Methods ·The Cancer Genome Atlas (TCGA) was searched to analyze the expression levels of RBX1 in tumors and the correlation with clinical stages and survival prognosis. RBX1 was transiently knocked down in the UVM cell lines, i.e., 92.1, OMM2.3 and MEL290 by using small interfering RNAs (siRNAs) targeting RBX1. RNA sequencing was performed on the 92.1 cells with transient knockdown of RBX1, and the differentially expressed genes between the siRBX1-transfected cells and control cells were analyzed by gene set enrichment analysis (GSEA) to investigate the relationship between RBX1 and tumor immune-related genes. Based on the results of the analysis, signal transducer and activator of transcription 1 (STAT1) and its downstream CXC chemokine ligand 9 (CXCL9) and CXCL10 mRNA expression levels were detected by real-time fluorescence quantitative PCR (qPCR) in 92.1, OMM2.3 and MEL290 cells with transient knockdown of RBX1, respectively. The protein expression levels of STAT1 and p-STAT1 in 92.1 cells were detected by Western blotting. The cell lines OMM2.3 and MEL290, in which RBX1 was transiently knocked down, were treated with 5 nmol/L or 10 nmol/L STAT1 inhibitor fludarabine for 48 h, and the mRNA expression levels of CXCL9 and CXCL10 were detected by qPCR. Results ·TCGA database analysis showed that RBX1 was highly expressed in a variety of tumors compared to the normal tissues, particularly in adrenocortical carcinoma and UVM. In addition, the patients with late stage of these two kinds of tumors had higher expression level of RBX1, and the patients with higher expression level of RBX1 had shorter overall survival time (P<0.05). RNA sequencing of 92.1 cells with transiently knocked down RBX1 and control cells revealed differential genes, and GSEA showed that RBX1 was involved in the regulation of tumor immune-related pathways. Heat map analysis showed an increase in STAT1 expression after RBX1 knockdown. In the 92.1, OMM2.3 and MEL290 cell lines, qPCR showed increases in STAT1, CXCL9 and CXCL10 mRNA expression after transient knockdown of RBX1, and Western blotting showed that STAT1 and p-STAT1 expression increased after knockdown of RBX1 in 92.1 cell lines. The increases of CXCL9 and CXCL10 mRNA in OMM2.3 and MEL290 cell lines were suppressed by STAT1 inhibitors. Conclusion ·RBX1 may regulate CXCL9 and CXCL10 expression via STAT1 in UVM cells and is involved in tumor immune regulation.

Key words: uveal melanoma (UVM), ring-box protein 1 (RBX1), tumor immunity, signal transducer and activator of transcription 1 (STAT1)

CLC Number:

R739.7

ZHOU Xiaowen, LI Qian, ZHANG Zhe, SHEN Jianfeng, FAN Xianqun. RBX1 regulates uveal melanoma immune-related genes via STAT1[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 709-717.

Figures/Tables 8

Tab 1 siRNA sequences

Primer name	Sequence (5'→3')
siRBX1-1	GGGAUAUUGUGGUUGAUAAtt
siRBX1-2	CAGACCGUGUGUUUCCAAAtt

Tab 2 Primer sequences for qPCR analysis

Gene	Forward (5'→3')	Reverse (5'→3')
β-actin	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT
RBX1	TTGTGGTTGATAACTGTGCCAT	GACGCCTGGTTAGCTTGACAT
STAT1	CAGCTTGACTCAAAATTCCTGGA	TGAAGATTACGCTTGCTTTTCCT
CXCL9	TGAGAAAGGGTCGCTGTTCC	TCAAACTGCTTGGCTCACCA
CXCL10	GCTTCCAAGGATGGACCACA	GCAGGGTCAGAACATCCACT

Fig 1 Expression of RBX1 in tumors and its effect on patients' survival

Fig 2 Relationships of RBX1 expression level with stages and overall survivals of UVM and ACC patients

Fig 3 Expression changes of RBX1 mRNA and protein in UVM cell lines transfected with siRNA

Fig 4 Effect of RBX1 knockdown on immune-related pathways in 92.1 cell line

Fig 5 Regulation of RBX1 on STAT1 and related genes expressions in UVM cell lines

Fig 6 Effect of STAT1 inhibitor on the mRNA expression of CXCL9 and CXCL10 in UVM cell lines after RBX1 knockdown

TrendMD

References 21

1	GÜRTLER C, BOWIE A G. Innate immune detection of microbial nucleic acids[J]. Trends Microbiol, 2013, 21(8): 413-420.
2	WU J X, CHEN Z J. Innate immune sensing and signaling of cytosolic nucleic acids[J]. Annu Rev Immunol, 2014, 32: 461-488.
3	JIANG X M, CHEN Z J. The role of ubiquitylation in immune defence and pathogen evasion[J]. Nat Rev Immunol, 2011, 12(1): 35-48.
4	LEI C Q, ZHONG B, ZHANG Y, et al. Glycogen synthase kinase 3β regulates IRF3 transcription factor-mediated antiviral response via activation of the kinase TBK1[J]. Immunity, 2010, 33(6): 878-889.
5	ARTHUR J S C, LEY S C. Mitogen-activated protein kinases in innate immunity[J]. Nat Rev Immunol, 2013, 13(9): 679-692.
6	LIU J, QIAN C, CAO X T. Post-translational modification control of innate immunity[J]. Immunity, 2016, 45(1): 15-30.
7	ENCHEV R I, SCHULMAN B A, PETER M. Protein neddylation: beyond cullin-RING ligases[J]. Nat Rev Mol Cell Biol, 2015, 16(1): 30-44.
8	YANG D, LI L, LIU H, et al. Induction of autophagy and senescence by knockdown of ROC1 E3 ubiquitin ligase to suppress the growth of liver cancer cells[J]. Cell Death Differ, 2013, 20(2): 235-247.
9	JIA L J, SOENGAS M S, SUN Y. ROC1/RBX1 E3 ubiquitin ligase silencing suppresses tumor cell growth via sequential induction of G2-M arrest, apoptosis, and senescence[J]. Cancer Res, 2009, 69(12): 4974-4982.
10	ZHANG J Y, LI S, SHANG Z Y, et al. Targeting the overexpressed ROC1 induces G2 cell cycle arrest and apoptosis in esophageal cancer cells[J]. Oncotarget, 2017, 8(17): 29125-29137.
11	CHEN P, LUO X T, CHE Z H, et al. Targeting of the C-Jun/BCL-XL/P21 axis accelerates the switch from senescence to apoptosis upon ROC1 knockdown in gastric cancer cells[J]. Cell Physiol Biochem, 2018, 48(3): 1123-1138.
12	WU Q, ZHOU X Q, LI P, et al. ROC1 promotes the malignant progression of bladder cancer by regulating p-IκBα/NF-κB signaling[J]. J Exp Clin Cancer Res, 2021, 40(1): 158.
13	SHAO J, FENG Q, JIANG W F, et al. E3 ubiquitin ligase RBX1 drives the metastasis of triple negative breast cancer through a FBXO45-TWIST1-dependent degradation mechanism[J]. Aging, 2022, 14(13): 5493-5510.
14	XING R, CHEN K B, XUAN Y, et al. RBX1 expression is an unfavorable prognostic factor in patients with non-small cell lung cancer[J]. Surg Oncol, 2016, 25(3): 147-151.
15	BUNGSY M, PALMER M C L, JEUSSET L M, et al. Reduced RBX1 expression induces chromosome instability and promotes cellular transformation in high-grade serous ovarian cancer precursor cells[J]. Cancer Lett, 2021, 500: 194-207.
16	JAGER M J, SHIELDS C L, CEBULLA C M, et al. Uveal melanoma[J]. Nat Rev Dis Primers, 2020, 6(1): 24.
17	TOLOMEO M, CAVALLI A, CASCIO A. STAT1 and its crucial role in the control of viral infections[J]. Int J Mol Sci, 2022, 23(8): 4095.
18	STARK G R, DARNELL J E Jr. The JAK-STAT pathway at twenty[J]. Immunity, 2012, 36(4): 503-514.
19	JANDL K, MARSH L M, MUTGAN A C, et al. Impairment of the NKT-STAT1-CXCL9 axis contributes to vessel fibrosis in pulmonary hypertension caused by lung fibrosis[J]. Am J Respir Crit Care Med, 2022, 206(8): 981-998.
20	SHANG S, YANG Y W, CHEN F, et al. TRIB3 reduces CD8⁺ T cell infiltration and induces immune evasion by repressing the STAT1-CXCL10 axis in colorectal cancer[J]. Sci Transl Med, 2022, 14(626): eabf0992.
21	BACH E A, AGUET M, SCHREIBER R D. The IFN gamma receptor: a paradigm for cytokine receptor signaling[J]. Annu Rev Immunol, 1997, 15: 563-591.

[1]	Ling-ling LI, Qian LI, Ming-yu LI, Zheng LIU, Qian-cheng SHEN. Analysis of tumor immune-related differentially expressed genes in adults and children with acute myeloid leukemia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(5): 579-587.
[2]	ZHAO Wei-guang, LIU Zhi-hong. Advances in study of regulation of tumor immune inflammatory microenvironment by cancer-associated fibroblasts [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1288-1293.
[3]	FU Yu-jie, GAO Jian-xin, LI Lin-feng, ZHAO Xiao-jing. Correlation and function of NK cells and NKDCs [J]. , 2016, 36(6): 814-.