Effect of ceria nanoparticles on activity of DSS-induced colitis in mice by eliminating active oxygen species

doi:10.3969/j.issn.1674-8115.2024.01.004

Abstract

Abstract:

Objective ·To investigate the effect of ceria nanoparticles-polyethylene glycol (CeNP-PEG) on scavenging reactive oxygen species (ROS) and alleviating disease activity in dextran sulphate sodium (DSS)-induced colitis mice. Methods ·CeNP was synthesized with the hydrates of cerium acetate, oleamine, and xylene, which was modified with polyethylene glycol-stearyl phosphatidylethanolamine (mPEG-DPSE) to obtain CeNP-PEG. Then CeNP-PEG was purified. The particle size and zeta potential of CeNP-PEG were measured by using transmission electron microscopy (TEM) and dynamic light scattering (DLS). Mouse macrophages (Raw264.7) were cultured in vitro and induced to a pro-inflammatory phenotype (M1 phenotype). M1 macrophages were treated with 0.5 μg/mL and 1.0 μg/mL CeNP-PEG, respectively, and then Western blotting was used to detect the expression changes of the proteins related with nuclear factor-κB (NF-κB) signaling pathway. DSS-induced colitis mice models were constructed, and CeNP-PEG (1.0 mg/mL) was intravenously administrated for 3 times via tail vein during the modeling period. Meanwhile, the body weight, fecal characteristics, and frequency of rectal bleeding in mice were monitored in the normal control group (Normal group), the model group (DSS group), and the CeNP-PEG treatment group. The disease activity index (DAI) was calculated to evaluate the intestinal inflammation. The level of ROS in mouse intestinal tissues was detected by dihydroethidine (DHE) staining and the mRNA expression levels of inflammatory cytokines interferon-γ (Ifn-γ), interleukin-6 (Il-6), Il-1β and tumor necrosis factor-α (Tnf-α) were detected by real-time quantitative PCR (RT-qPCR). Results ·The hydrated particle size of synthesized CeNP-PEG was (6.96±0.27) nm, and the average zeta potential was (-6.02±1.31) mV. Western blotting results showed that the expression of p-P65 increased in the pro-inflammatory macrophages compared with the control group. The expression of NF-κB inhibitor-α (IκB-α) decreased, and their expressions tended to recover after the intervention of different concentrations of CeNP-PEG. In the DSS-induced colitis models, mice in the CeNP-PEG treatment group lost less weight than those in the DSS group (P=0.000) and had lower DAI scores (P=0.000). The RT-qPCR results of intestinal tissues showed that the mRNA levels of Ifn-γ, Il-1β, Il-6 and Tnf-α in the DSS group were significantly up-regulated compared with those in the Normal group (P=0.000), and all of them significantly decreased in the CeNP-PEG treatment group. The results of DHE staining showed that the fluorescence intensity of intestinal tissues in the DSS group was significantly enhanced than that in the Normal group, and the fluorescence intensity decreased in the CeNP-PEG treatment group. Conclusion ·CeNP-PEG can inhibit the expression of intestinal inflammatory factors and the activation of NF-κB-related inflammatory pathway of pro-inflammatory macrophages, eliminate intestinal ROS, improve the intestinal inflammatory microenvironment, and alleviate the disease activity of DSS-induced colitis in mice.

Key words: inflammatory bowel disease, ceria nanoparticles (CeNP), reactive oxygen species (ROS), Crohn disease, ulcerative colitis

CLC Number:

R574.62

LU Yuhan, SHI Yahong, LONG Manmei, WANG Zi, WU Yingwei. Effect of ceria nanoparticles on activity of DSS-induced colitis in mice by eliminating active oxygen species[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(1): 35-42.

Figures/Tables 6

Tab 1 Primer sequences for RT-qPCR

Gene	Sequence (5′→3′)
Tnf-α	Forward: CCTGTAGCCCACGTCGTAGC Reverse: AGCAATGACTCCAAAGTAGACC
Il-6	Forward: ATCCAGTTGCCTTCTTGGGACTGA Reverse: TGGCTAAGGACCAAGACCATCCAA
Il-1β	Forward: CTTCAGGCAGGCAGTATCACTC Reverse: TGCAGTTGTCTAATGGGAACGT
Ifn-γ	Forward: AGCAACAGCAAGGCGAAA Reverse: CTGGACCTGTGGGTTGTTGA
actin	Forward: CAGCCTTCCTTCTTGGGTATG Reverse: GGCATAGAGGTCTTTACGGATG

Fig 1 Representation of CeNP and CeNP-PEG

Fig 2 Effect of CeNP-PEG on the expression levels of NF-κB pro-inflammatory signaling pathway-associated proteins in murine macrophages

Fig 3 Evaluation of the effect of CeNP-PEG on reducing disease activity in the mice with colitis

Fig 4 Effect of CeNP-PEG on the expression of proinflammatory cytokines in the colonic tissues of colitis mice

Fig 5 Effect of CeNP-PEG on ROS levels in the colonic tissues of colitis mice

TrendMD

References 18

1	HODSON R. Inflammatory bowel disease[J]. Nature, 2016, 540(7634): S97.
2	MOZDIAK E, O′MALLEY J, ARASARADNAM R. Inflammatory bowel disease[J]. BMJ, 2015, 351: h4416.
3	BEN-HORIN S, KOPYLOV U, CHOWERS Y. Optimizing anti-TNF treatments in inflammatory bowel disease[J]. Autoimmun Rev, 2014, 13(1): 24-30.
4	NIELSEN O H. New strategies for treatment of inflammatory bowel disease[J]. Front Med, 2014, 1: 3.
5	KAMBA A, LEE I A, MIZOGUCHI E. Potential association between TLR4 and chitinase 3-like 1 (CHI3L1/YKL-40) signaling on colonic epithelial cells in inflammatory bowel disease and colitis-associated cancer[J]. Curr Mol Med, 2013, 13(7): 1110-1121.
6	RENDRA E, RIABOV V, MOSSEL D M, et al. Reactive oxygen species (ROS) in macrophage activation and function in diabetes[J]. Immunobiology, 2019, 224(2): 242-253.
7	NI D L, WEI H, CHEN W Y, et al. Ceria nanoparticles meet hepatic ischemia-reperfusion injury: the perfect imperfection[J]. Adv Mater, 2019, 31(40): e1902956.
8	ZENG F, WU Y W, LI X W, et al. Custom-made ceria nanoparticles show a neuroprotective effect by modulating phenotypic polarization of the microglia[J]. Angew Chem Int Ed Engl, 2018, 57(20): 5808-5812.
9	KWON H J, KIM D, SEO K, et al. Ceria nanoparticle systems for selective scavenging of mitochondrial, intracellular, and extracellular reactive oxygen species in Parkinson's disease[J]. Angew Chem Int Ed Engl, 2018, 57(30): 9408-9412.
10	SUN Y, SUN X L, LI X, et al. A versatile nanocomposite based on nanoceria for antibacterial enhancement and protection from aPDT-aggravated inflammation via modulation of macrophage polarization[J]. Biomaterials, 2021, 268: 120614.
11	WANG M L, ZENG F, NING F L, et al. Ceria nanoparticles ameliorate renal fibrosis by modulating the balance between oxidative phosphorylation and aerobic glycolysis[J]. J Nanobiotechnol, 2022, 20(1): 3.
12	PAPAMICHAEL K, GILS A, RUTGEERTS P, et al. Role for therapeutic drug monitoring during induction therapy with TNF antagonists in IBD: evolution in the definition and management of primary nonresponse[J]. Inflamm Bowel Dis, 2015, 21(1): 182-197.
13	MIAO X Y, LENG X F, ZHANG Q. The current state of nanoparticle-induced macrophage polarization and reprogramming research[J]. Int J Mol Sci, 2017, 18(2): 336.
14	SHAPOURI-MOGHADDAM A, MOHAMMADIAN S, VAZINI H, et al. Macrophage plasticity, polarization, and function in health and disease[J]. J Cell Physiol, 2018, 233(9): 6425-6440.
15	LIU H, DASGUPTA S, FU Y, et al. Subsets of mononuclear phagocytes are enriched in the inflamed colons of patients with IBD[J]. BMC Immunol, 2019, 20(1): 42.
16	PEREIRA C, GRÁCIO D, TEIXEIRA J P, et al. Oxidative stress and DNA damage: implications in inflammatory bowel disease[J]. Inflamm Bowel Dis, 2015, 21(10): 2403-2417.
17	ORÓ D, YUDINA T, FERNÁNDEZ-VARO G, et al. Cerium oxide nanoparticles reduce steatosis, portal hypertension and display anti-inflammatory properties in rats with liver fibrosis[J]. J Hepatol, 2016, 64(3): 691-698.
18	KHURANA A, TEKULA S, GODUGU C. Nanoceria suppresses multiple low doses of streptozotocin-induced type 1 diabetes by inhibition of Nrf2/NF-κB pathway and reduction of apoptosis[J]. Nanomedicine, 2018, 13(15): 1905-1922.

[1]	LI Bowen, LIU Ningning, WANG Hui. Advances in gut microbiota in the pathogenesis and treatment of inflammatory bowel disease [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 364-368.
[2]	GE Yiqin, HUANG Yuji, LI Weize, LI Yanning, LI Li. Effect of intragastric treatment of sodium cromoglycate on dextran sulfate sodium-induced ulcerative colitis in BALB/c mice [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(10): 1375-1382.
[3]	Ya-zhong WEI, Xiao-mei XUE, Bin HE. Research progress in myocardial ischemia-reperfusion injury mediated by mitochondrial reactive oxygen species [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 826-829.
[4]	Yu-jie XIE, Li-juan XIE, Tian-wen ZHU, Yi-wen WANG. Study on interleukin-10 receptor A gene mutations-induced neonatal very early onset inflammatory bowel disease in 2 infants [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(3): 409-412.
[5]	CHEN Wei, HAN Zheng, ZOU Yan-li, HUANG Sha-sha, TIAN Xia. Expressions and effects of serum miR-23a-3p and miR-27a-3p in mice with ulcerative colitis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(8): 1069-1074.
[6]	LI Yue1, 2, SUN Han-xiao2, SHU Jie2, LI Yong-mei1#, SHENG Hui-ming2#. Anti-inflammatory effects of liraglutide on innate lymphoid cells in mice with inflammatory bowel disease [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(6): 744-751.
[7]	XIA Shou-bing, XU Chun-jie, JIANG Chun-hui, GU Lei, SUN Long-ci, XU Qing. Bioinformatics analysis of ulcerative colitis and its malignant complications and screening of potential therapeutic drugs [J]. , 2020, 40(3): 317-.
[8]	ZHOU Cheng, SUN Peng-fei, YIN Ji-yao, WANG Yang-yang, XIAO Hai-juan. Evolution of clinical treatment in inflammatory bowel diseasesfecal microbiota transplantation [J]. , 2020, 40(2): 267-.
[9]	ZHUANG Ling-fang, CHEN Kang. Regulating effect of fatty acid binding protein 3 on survival and apoptosis of cardiomyocytes under hypoxia [J]. , 2019, 39(6): 586-.
[10]	WANG Hong-mei,FU Jian-liang,ZHANG Ting,CHEN Jing-jiong,ZHAO Yu-wu. Inhibition of genistein against LPS-induced proinflammatory response in microglia [J]. , 2019, 39(5): 446-.
[11]	LIU Xin-ying, LU Wen-qing, SHEN Xin-xin, MA Rui -xiang, LIU Peng-yi, MA Jiao. Recent advances in the role of SIRT3 in leukemia drug resistance [J]. , 2019, 39(3): 331-.
[12]	WU Di, QI Jun. Advances in the mesoporous silica-based reactive oxygen species controlled-release nanosystem and its anti-tumor application [J]. , 2019, 39(11): 1329-.
[13]	LI Qi1, ZHOU Xiang-dong1, ZENG Man1, Victor P. KOLOSOV2, Juliy M. PERELMAN2. Role of inositol-requiring kinase 1α/X-box binding protein 1 in airway mucus secretion inducedneutrophil elastase [J]. , 2019, 39(1): 21-.
[14]	WANG Xiao1, 2, SUO Shi-teng1, ZHU Jiong1, FENG Qi1, HUA Xiao-lan1, WANG Wei-zhong2, GONG Jian-zhong2, LIU Jun1, LU Qing1. Application of intestinal CT texture analysis and nonlinear discriminant analysis in differential diagnosis of colorectal cancer and ulcerative colitis [J]. , 2018, 38(6): 624-.
[15]	YANG Mei, WANG Juan, RONG Wei-fang, ZHANG Guo-hua . Effects of preventive curcumin on lesion and expression of tryptophan hydroxylase in a rat model of ulcerative colitis [J]. , 2017, 37(1): 11-.