Immune inhibitory receptor LILRB2 enhances SARS-CoV-2 spike protein-mediated immune inflammation

doi:10.3969/j.issn.1674-8115.2022.09.005

Abstract

Abstract:

Objective ·To explore the possible roles of immune inhibitory receptor leukocyte immunoglobulin-like receptor subfamily B member 2 (LILRB2) in the immune inflammation after severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, and provide a potential therapeutic way for the coronavirus disease 2019 (COVID-19). Methods ·The supernatants containing the extracellular domain of spike protein (S-ECD) were collected, and the detection of the protein expression and activity in the conditional medium by Western blotting and flow cytometric analysis was followed by. The binding of S-ECD with LILRB2 was measured by co-immunoprecipitation and flow cytometric analysis. The mRNA expression levels of several inflammation genes in a human mononuclear cell line (THP1) or peripheral blood mononuclear cells (PBMC) were measured after spike protein stimulation for 24 h by quantitative RT-PCR. The protein levels of interleukin-6 (IL-6) and interleukin-1β (IL-1β) in the conditional medium were examined by enzyme-linked immunosorbent assay (ELISA). The siLILRB2 was transferred into CD33⁺ myeloid cells purified from human peripheral blood with Lipofectamine 3000 reagents. The knockdown efficiency was detected 24 h after transfection by flow cytometric analysis. The difference in the protein levels of IL-6 between the control cells and LILRB2-knocked-down cells after spike protein treatment was evaluated by ELISA. Results ·The study established a transfection system with 293T cells by which the SARS-CoV-2 S-ECD could be secreted to supernatants with normal biological activities. The interaction and the binding of spike protein with LILRB2 were evaluated by a co-immunoprecipitation assay and flow cytometric analysis, respectively. The mRNA expression levels of IL-6, IL-8, arginase 1 and IL-2 in THP1 cells were significantly up-regulated 24 h after spike protein treatment compared to the control cells (all P<0.05). Consistently, the mRNA levels of IL-6, transforming growth factor-β(TGF-β), IL-8, IL-10 and IL-1β in PBMC were notably increased after spike protein stimulation (all P<0.05). In addition, spike protein could also induce the release of IL-6 and IL-1β in PBMC as measured by ELISA (all P<0.05). More importantly, spike protein was able to increase the secretion of IL-1β and IL-6 by CD33⁺ myeloid cells 24 h after treatment (both P<0.05). LILRB2-overexpressing THP1 cells produced more IL-6 24 h after treatment with spike protein than the control cells (P<0.05). Two siRNAs could efficiently down-regulate the expression of LILRB2 in CD33⁺ cells as evaluated by flow cytometric analysis. Consistently, spike protein had no effect on the IL-6 secretion to supernatant from LILRB2-knockdown CD33⁺ myeloid cells. Conclusion ·SARS-CoV-2 can induce cytokine release syndrome by inflammatory factors, such as IL-6 and IL-1β, released by myeloid cells through spike protein binding to LILRB2.

Key words: severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), spike protein, leukocyte immunoglobulin-like receptor subfamily B member 2 (LILRB2), inflammatory cytokine, myeloid cell

CLC Number:

R363.1

YANG Wenqian, CHEN Chiqi, ZHAO Lu, CAO Liyuan, XIA Yiqiu, LU Zhigang, ZHENG Junke. Immune inhibitory receptor LILRB2 enhances SARS-CoV-2 spike protein-mediated immune inflammation[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1188-1196.

Figures/Tables 4

TrendMD

References 39

1	V'KOVSKI P, KRATZEL A, STEINER S, et al. Coronavirus biology and replication: implications for SARS-CoV-2[J]. Nat Rev Microbiol, 2021, 19(3): 155-170.
2	YAO H, SONG Y, CHEN Y, et al. Molecular architecture of the SARS-CoV-2 virus[J]. Cell, 2020, 183(3): 730-738.e13.
3	WALLS A C, PARK Y J, TORTORICI M A, et al. Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein[J]. Cell, 2020, 181(2): 281-292.e6.
4	HOFFMANN M, KLEINE-WEBER H, SCHROEDER S, et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor[J]. Cell, 2020, 181(2): 271-280.e8.
5	YAN R, ZHANG Y, LI Y, et al. Structural basis for the recognition of SARS-CoV-2 by full-length human ACE2[J]. Science, 2020, 367(6485): 1444-1448.
6	BENTON D J, WROBEL A G, XU P, et al. Receptor binding and priming of the spike protein of SARS-CoV-2 for membrane fusion[J]. Nature, 2020, 588(7837): 327-330.
7	WANG Q, ZHANG Y, WU L, et al. Structural and functional basis of SARS-CoV-2 entry by using human ACE2[J]. Cell, 2020, 181(4): 894-904. e9.
8	ZANG R, GOMEZ CASTRO M F, MCCUNE B T, et al. TMPRSS2 and TMPRSS4 promote SARS-CoV-2 infection of human small intestinal enterocytes[J]. Sci Immunol, 2020, 5(47): eabc3582.
9	WANG K, CHEN W, ZHANG Z, et al. CD147-spike protein is a novel route for SARS-CoV-2 infection to host cells[J]. Signal Transduct Target Ther, 2020, 5(1): 283.
10	MORNIROLI D, GIANNÌ M L, CONSALES A, et al. Human sialome and coronavirus disease-2019 (COVID-19) pandemic: an understated correlation?[J]. Front Immunol, 2020, 11: 1480.
11	CANTUTI-CASTELVETRI L, OJHA R, PEDRO L D, et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity[J]. Science, 2020, 370(6518): 856-860.
12	YANG X, YU Y, XU J, et al. Clinical course and outcomes of critically ill patients with SARS-CoV-2 pneumonia in Wuhan, China: a single-centered, retrospective, observational study[J]. Lancet Respir Med, 2020, 8(5): 475-481.
13	XU Z, SHI L, WANG Y, et al. Pathological findings of COVID-19 associated with acute respiratory distress syndrome[J]. Lancet Respir Med, 2020, 8(4): 420-422.
14	SOY M, KESER G, ATAGÜNDÜZ P. Pathogenesis and treatment of cytokine storm in COVID-19[J]. Turk J Biol, 2021, 45(4): 372-389.
15	LI G, FAN Y, LAI Y, et al. Coronavirus infections and immune responses[J]. J Med Virol, 2020, 92(4): 424-432.
16	LU Q, LIU J, ZHAO S, et al. SARS-CoV-2 exacerbates proinflammatory responses in myeloid cells through C-type lectin receptors and Tweety family member 2[J]. Immunity, 2021, 54(6): 1304-1319.e9.
17	CHEN H M, VAN DER TOUW W, WANG Y S, et al. Blocking immunoinhibitory receptor LILRB2 reprograms tumor-associated myeloid cells and promotes antitumor immunity[J]. J Clin Invest, 2018, 128(12): 5647-5662.
18	GU Y, CAO J, ZHANG X, et al. Receptome profiling identifies KREMEN1 and ASGR1 as alternative functional receptors of SARS-CoV-2[J]. Cell Res, 2022, 32(1): 24-37.
19	BOST P, GILADI A, LIU Y, et al. Host-viral infection maps reveal signatures of severe COVID-19 patients[J]. Cell, 2020, 181(7): 1475-1488.e12.
20	TANAKA T, NARAZAKI M, KISHIMOTO T. IL-6 in inflammation, immunity, and disease[J]. Cold Spring Harb Perspect Biol, 2014, 6(10): a016295.
21	VABRET N, BRITTON G J, GRUBER C, et al. Immunology of COVID-19: current state of the science[J]. Immunity, 2020, 52(6): 910-941.
22	GONG J, DONG H, XIA Q S, et al. Correlation analysis between disease severity and inflammation-related parameters in patients with COVID-19: a retrospective study[J]. BMC Infect Dis, 2020, 20(1): 963.
23	EVEREST H, STEVENSON-LEGGETT P, BAILEY D, et al. Known cellular and receptor interactions of animal and human coronaviruses: a review[J]. Viruses, 2022, 14(2): 351.
24	WANG W, TANG J, WEI F. Updated understanding of the outbreak of 2019 novel coronavirus (2019-nCoV) in Wuhan, China[J]. J Med Virol, 2020, 92(4): 441-447.
25	COSTELA-RUIZ V J, ILLESCAS-MONTES R, PUERTA-PUERTA J M, et al. SARS-CoV-2 infection: the role of cytokines in COVID-19 disease[J]. Cytokine Growth Factor Rev, 2020, 54: 62-75.
26	GUBERNATOROVA E O, GORSHKOVA E A, POLINOVA A I, et al. IL-6: relevance for immunopathology of SARS-CoV-2[J]. Cytokine Growth Factor Rev, 2020, 53: 13-24.
27	POTERE N, BATTICCIOTTO A, VECCHIÉ A, et al. The role of IL-6 and IL-6 blockade in COVID-19[J]. Expert Rev Clin Immunol, 2021, 17(6): 601-618.
28	DERAKHSHANI A, HEMMAT N, ASADZADEH Z, et al. Arginase 1 (Arg1) as an up-regulated gene in COVID-19 patients: a promising marker in COVID-19 immunopathy[J]. J Clin Med, 2021, 10(5): 1051.
29	ZUO J, DOWELL A C, PEARCE H, et al. Robust SARS-CoV-2-specific T cell immunity is maintained at 6 months following primary infection[J]. Nat Immunol, 2021, 22(5): 620-626.
30	JONES S A, HUNTER C A. Is IL-6 a key cytokine target for therapy in COVID-19?[J]. Nat Rev Immunol, 2021, 21(6): 337-339.
31	FERREIRA-GOMES M, KRUGLOV A, DUREK P, et al. SARS-CoV-2 in severe COVID-19 induces a TGF-β-dominated chronic immune response that does not target itself[J]. Nat Commun, 2021, 12(1): 1961.
32	KUDO T, HAYASHI Y, KUNIEDA K, et al. Persistent intrathecal interleukin-8 production in a patient with SARS-CoV-2-related encephalopathy presenting aphasia: a case report[J]. BMC Neurol, 2021, 21(1): 426.
33	HAN H, MA Q F, LI C, et al. Profiling serum cytokines in COVID-19 patients reveals IL-6 and IL-10 are disease severity predictors[J]. Emerg Microbes Infect, 2020, 9(1): 1123-1130.
34	TRIPATHY A S, VISHWAKARMA S, TRIMBAKE D, et al. Pro-inflammatory CXCL-10, TNF-α, IL-1β, and IL-6: biomarkers of SARS-CoV-2 infection[J]. Arch Virol, 2021, 166(12): 3301-3310.
35	GIAMARELLOS-BOURBOULIS E J, NETEA M G, ROVINA N, et al. Complex immune dysregulation in COVID-19 patients with severe respiratory failure[J]. Cell Host Microbe, 2020, 27(6): 992-1000.e3.
36	MOORE J B, JUNE C H. Cytokine release syndrome in severe COVID-19[J]. Science, 2020, 368(6490): 473-474.
37	LUO P, LIU Y, QIU L, et al. Tocilizumab treatment in COVID-19: a single center experience[J]. J Med Virol, 2020, 92(7): 814-818.
38	GAUTRET P, LAGIER J C, PAROLA P, et al. Hydroxychloroquine and azithromycin as a treatment of COVID-19: results of an open-label non-randomized clinical trial[J]. Int J Antimicrob Agents, 2020, 56(1): 105949.
39	WU D, YANG X O. TH17 responses in cytokine storm of COVID-19: an emerging target of JAK2 inhibitor fedratinib[J]. J Microbiol Immunol Infect, 2020, 53(3): 368-370.

Gene （human）	Forward sequence （5'→3'）	Reverse sequence （5'→3'）
IL-6	ACTCACCTCTTCAGAACGAATTG	CCATCTTTGGAAGGTTCAGGTTG
IL-8	ACTGAGAGTGATTGAGAGTGGAC	AACCCTCTGCACCCAGTTTTC
IL-2	TCCTGTCTTGCATTGCACTAAG	CATCCTGGTGAGTTTGGGATTC
IL-10	GACTTTAAGGGTTACCTGGGTTG	TCACATGCGCCTTGATGTCTG
IL-1β	ATGATGGCTTATTACAGTGGCAA	GTCGGAGATTCGTAGCTGGA
ARG-1^①	TGGACAGACTAGGAATTGGCA	CCAGTCCGTCAACATCAAAACT
TGF-β	GGCCAGATCCTGTCCAAGC	GTGGGTTTCCACCATTAGCAC
actin	AGAGCTACGAGCTGCCTGAC	AGCACTGTGTTGGCGTACAG

Gene （human）	Forward sequence （5'→3'）	Reverse sequence （5'→3'）
IL-6	ACTCACCTCTTCAGAACGAATTG	CCATCTTTGGAAGGTTCAGGTTG
IL-8	ACTGAGAGTGATTGAGAGTGGAC	AACCCTCTGCACCCAGTTTTC
IL-2	TCCTGTCTTGCATTGCACTAAG	CATCCTGGTGAGTTTGGGATTC
IL-10	GACTTTAAGGGTTACCTGGGTTG	TCACATGCGCCTTGATGTCTG
IL-1β	ATGATGGCTTATTACAGTGGCAA	GTCGGAGATTCGTAGCTGGA
ARG-1^①	TGGACAGACTAGGAATTGGCA	CCAGTCCGTCAACATCAAAACT
TGF-β	GGCCAGATCCTGTCCAAGC	GTGGGTTTCCACCATTAGCAC
actin	AGAGCTACGAGCTGCCTGAC	AGCACTGTGTTGGCGTACAG

[1]	JIANG Gan, YANG Yuquan, CHEN Yaoxing, HOU Zhaoyuan, GAO Xiaoling, CHEN Hongzhuan, JIA Hao. Preliminary study on the cellular level of SARS-CoV-2 proteins mediated by macropinocytosis pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 987-996.
[2]	Xiaowen ZHANG, Yi WANG, Chan ZHANG, Di ZHANG, Hang YUN, Di HUANG. Effects of Pcsk9 gene interference on high fat-induced nonalcoholic fatty liver disease with atherosclerosis in rats [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 150-157.
[3]	Rui CHEN, Yun ZHAO, Xiao-xia ZHAO, Dong MA, Yi-jiang HAN, Deng-ming LAI, Wei-zhong GU, Jin-fa TOU. Expression characteristics of silent information regulator transcript 1 in intestinal tissues of neonatal necrotizing enterocolitis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(9): 1154-1161.
[4]	Jia-qiang LUO, Liang-yu ZHAO, Chen-cheng YAO, Zi-jue ZHU, Xiao-yu XING, Peng LI, Ru-hui TIAN, Hui-xing CHEN, Jie SUN, Zheng LI. Single-cell RNA sequencing reveals the spatio-temporal expression profile of SARS-CoV-2 related receptor in human and mouse testes [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(4): 421-426.
[5]	WANG Xiao-yu, CUI Li. A source-seeking analysis and its implication on the transmission of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) [J]. , 2020, 40(2): 149-.
[6]	WANG Ling-xiao, LIU Ting-ting, YANG Xiao-hui, YAO Zhi-qing, CAI Hui-zhen. Effect of Lycium barbarum polysaccharides on inflammatory cytokines in type 2 diabetes mellitus model mice without myeloid differentiation factor 88 gene [J]. , 2019, 39(2): 136-.
[7]	ZHOU Ju-mei1, YUAN Ke-yong2, LIN Wen-zhen2, HU Xu-chen2, JIN Qiao-qiao2, NIU Chen-guang2. Influence of 3,3’-diindolylmethane on expression of inflammatory cytokines in periodontal ligament cells induced by lipopolysaccharide [J]. , 2018, 38(2): 138-.
[8]	LU Yang, XUE Fei, ZHAO Hong-sheng, et al. Effect of dexmedetomidine on expression of triggering receptor expressed on myeloid cells-1 in lung tissues of rats with sepsis [J]. , 2015, 35(9): 1274-.
[9]	HUANG Hai-yuan, PAN Xing-shou, HUANG Xian-nan, et al. Effects of atorvastatin on hypertension patients with dyslipidemia and body's inflammatory response [J]. , 2014, 34(11): 1642-.
[10]	SHANG Jia-wei, LIU Xi, WEI Hai-ling, et al. Activation of proinflammatory cytokines and transduction pathways in acute fat embolism syndrome mouse model [J]. , 2013, 33(2): 140-.
[11]	WAN Yan-ping, XU Ren-ying, SHEN Wan-rong, et al. Distribution of HOMA-IR index and its relationship with metabolic syndrome and inflammatory cytokines in students aged 7 to 14 years [J]. , 2010, 30(1): 16-.
[12]	HUANG Cui-hua. Energy metabolism and related mechanism in patients with malignant tumors [J]. , 2010, 30(1): 42-.