Periodontitis aggravates transverse aortic constriction-induced cardiac hypertrophy in mice

doi:10.3969/j.issn.1674-8115.2022.09.014

Abstract

Abstract:

Objective ·To study the effects of periodontitis (PD) on transverse aortic constriction (TAC)-induced cardiac hypertrophy in mice and explore the mechanisms. Methods ·Twenty-five C57BL/6J mice were randomly divided into Sham operation (Sham) group, transverse aortic constriction (TAC) group, and periodontitis combined with TAC (TAC+PD) group. PD was induced by ligation of mouse molars and application of subgingival plaques of PD patients. TAC surgery was performed after the establishment of PD model. Cardiac function was assessed by echocardiography at 4 weeks after Sham or TAC surgery. The mice were then sacrificed and the samples were collected for quantitative realtime PCR (qRT-PCR), immunohistochemistry, immunofluorescence, and 16S rRNA gene sequencing. Results ·The mice in the TAC+PD group manifested significantly more resorption of the alveolar bone and higher expression of inflammatory genes in gingiva compared to Sham and TAC groups, demonstrating successful establishment of PD models in TAC mice. Compared to those in the TAC group, the mice in the TAC+PD group had significantly lower left ventricular ejection fraction (EF) and left ventricular shortening fraction (FS), illustrating that PD exacerbated TAC-induced cardiac dysfunction. Compared to those in the TAC group, the mice in the TAC+PD group had significantly bigger heart weight to body weight ratio (HW/BW) and heart weight to tibia length ratio (HW/TL), lung weight to body weight ratio (LW/BW), and cross-sectional area of cardiomyocytes, as well as higher expression of hypertrophy-related genes, demonstrating that PD exacerbated TAC-induced cardiac hypertrophy and heart failure. Compared to those in the TAC group, the mice in the TAC+PD group had significantly larger fibrotic areas and higher expression of fibrosis-related genes in the heart, bigger spleen weight to tibia length ratio (SW/TL) and higher expression of inflammatory genes in the heart, illustrating that PD exacerbated TAC-induced cardiac fibrosis and inflammation. Results of 16S rRNA gene sequencing showed that relative abundances of Streptococcus and Veillonella were significantly increased in the oral ligatures of mice in the TAC+PD group compared to the TAC group. Relative abundances of Ralstonia, and Pelomonas were significantly increased in the hearts of mice in the TAC+PD group. Comparison of oral microbiota and heart microbiota of the mice in the TAC+PD group revealed that relative abundances of Ralstonia and Pelomonas in hearts were significantly higher than those in oral ligatures. Conclusion ·PD aggravates TAC-induced cardiac dysfunction, cardiac hypertrophy, fibrosis, and inflammation in mice. The mechanisms may be related to alterations in oral microbiota, particularly bacterial genera including Ralstonia and Pelomonas.

Key words: periodontitis (PD), transverse aortic constriction (TAC), cardiac hypertrophy, oral microbiota

CLC Number:

R365

LI Lu, LI Yulin, LIU Yan, DUAN Shengzhong. Periodontitis aggravates transverse aortic constriction-induced cardiac hypertrophy in mice[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1275-1287.

Figures/Tables 9

TrendMD

References 41

1	BROWN L J, OLIVER R C, LÖE H. Periodontal diseases in the US in 1981: prevalence, severity, extent, and role in tooth mortality[J]. J Periodontol, 1989, 60(7): 363-370.
2	KASSEBAUM N J, BERNABÉ E, DAHIYA M, et al. Global burden of severe periodontitis in 1990‒2010: a systematic review and meta-regression[J]. J Dent Res, 2014, 93(11): 1045-1053.
3	SANZ M, MARCO DEL CASTILLO A, JEPSEN S, et al. Periodontitis and cardiovascular diseases: consensus report[J]. J Clin Periodontol, 2020, 47(3): 268-288.
4	HAJISHENGALLIS G, CHAVAKIS T. Local and systemic mechanisms linking periodontal disease and inflammatory comorbidities[J]. Nat Rev Immunol, 2021, 21(7): 426-440.
5	BOURGEOIS D, INQUIMBERT C, OTTOLENGHI L, et al. Periodontal pathogens as risk factors of cardiovascular diseases, diabetes, rheumatoid arthritis, cancer, and chronic obstructive pulmonary disease: is there cause for consideration? [J]. Microorganisms, 2019, 7(10): 424.
6	HILL J A, OLSON E N. Cardiac plasticity[J]. N Engl J Med, 2008, 358(13): 1370-1380.
7	SHIMIZU I, MINAMINO T. Physiological and pathological cardiac hypertrophy[J]. J Mol Cell Cardiol, 2016, 97: 245-262.
8	NAKAMURA M, SADOSHIMA J. Mechanisms of physiological and pathological cardiac hypertrophy[J]. Nat Rev Cardiol, 2018, 15(7): 387-407.
9	BAI L, CHEN B Y, LIU Y, et al. A mouse periodontitis model with humanized oral bacterial community[J]. Front Cell Infect Microbiol, 2022, 12: 842845.
10	WEI X, WU B, ZHAO J, et al. Myocardial hypertrophic preconditioning attenuates cardiomyocyte hypertrophy and slows progression to heart failure through upregulation of S100A8/A9[J]. Circulation, 2015, 131(17): 1506-1517;discussion1517.
11	ZAURA E, KEIJSER B J F, HUSE S M, et al. Defining the healthy “core microbiome” of oral microbial communities[J]. BMC Microbiol, 2009, 9: 259.
12	SEGATA N, IZARD J, WALDRON L, et al. Metagenomic biomarker discovery and explanation[J]. Genome Biol, 2011, 12(6): R60.
13	KOREN O, SPOR A, FELIN J, et al. Human oral, gut, and plaque microbiota in patients with atherosclerosis[J]. Proc Natl Acad Sci U S A, 2011, 108(Suppl 1): 4592-4598.
14	KINANE D F, STATHOPOULOU P G, PAPAPANOU P N. Periodontal diseases[J]. Nat Rev Dis Primers, 2017, 3: 17038.
15	ARMINGOHAR Z, JØRGENSEN J J, KRISTOFFERSEN A K, et al. Bacteria and bacterial DNA in atherosclerotic plaque and aneurysmal wall biopsies from patients with and without periodontitis[J]. J Oral Microbiol, 2014, 6. DOI: 10.3402/jom.v6.23408.eCollection 2014.
16	MAHENDRA J, MAHENDRA L, FELIX J, et al. Prevelance of periodontopathogenic bacteria in subgingival biofilm and atherosclerotic plaques of patients undergoing coronary revascularization surgery[J]. J Indian Soc Periodontol, 2013, 17(6): 719-724.
17	SHI B C, LUX R, KLOKKEVOLD P, et al. The subgingival microbiome associated with periodontitis in type 2 diabetes mellitus[J]. ISME J, 2020, 14(2): 519-530.
18	LIU X H, TIAN K, MA X R, et al. Analysis of subgingival microbiome of periodontal disease and rheumatoid arthritis in Chinese: a case-control study[J]. Saudi J Biol Sci, 2020, 27(7): 1835-1842.
19	KNÖLL R, IACCARINO G, TARONE G, et al. Towards a re-definition of 'cardiac hypertrophy' through a rational characterization of left ventricular phenotypes: a position paper of the Working Group 'Myocardial Function' of the ESC[J]. Eur J Heart Fail, 2011, 13(8): 811-819.
20	MCLELLAN A J A, ELLIMS A H, PRABHU S, et al. Diffuse ventricular fibrosis on cardiac magnetic resonance imaging associates with ventricular tachycardia in patients with hypertrophic cardiomyopathy[J]. J Cardiovasc Electrophysiol, 2016, 27(5): 571-580.
21	ALMAAS V M, HAUGAA K H, STRØM E H, et al. Increased amount of interstitial fibrosis predicts ventricular arrhythmias, and is associated with reduced myocardial septal function in patients with obstructive hypertrophic cardiomyopathy[J]. Europace, 2013, 15(9): 1319-1327.
22	MANN D L. Innate immunity and the failing heart: the cytokine hypothesis revisited[J]. Circ Res, 2015, 116(7): 1254-1268.
23	TRACHTENBERG B H, HARE J M. Inflammatory cardiomyopathic syndromes[J]. Circ Res, 2017, 121(7): 803-818.
24	HEUSCH G, LIBBY P, GERSH B, et al. Cardiovascular remodelling in coronary artery disease and heart failure[J]. Lancet, 2014, 383(9932): 1933-1943.
25	WEI Y P, SHI M, ZHEN M, et al. Comparison of subgingival and buccal mucosa microbiome in chronic and aggressive periodontitis: a pilot study[J]. Front Cell Infect Microbiol, 2019, 9: 53.
26	JI S, KIM Y, MIN B M, et al. Innate immune responses of gingival epithelial cells to nonperiodontopathic and periodontopathic bacteria[J]. J Periodontal Res, 2007, 42(6): 503-510.
27	PINHO-GOMES A C, NASIR A, MOSCA R, et al. Intraoperative diagnosis of mitral valve endocarditis secondary to Paenibacillus provencensis[J]. Ann R Coll Surg Engl, 2017, 99(2): e54-e55.
28	ZIGANSHINA E E, SHARIFULLINA D M, LOZHKIN A P, et al. Bacterial communities associated with atherosclerotic plaques from Russian individuals with atherosclerosis[J]. PLoS One, 2016, 11(10): e0164836.
29	SCHÄFFLER H, HERLEMANN D P R, ALBERTS C, et al. Mucosa-attached bacterial community in Crohn′s disease coheres with the clinical disease activity index[J]. Environ Microbiol Rep, 2016, 8(5): 614-621.
30	WANG Z N, HAZEN J, JIA X, et al. The nutritional supplement L-alpha glycerylphosphorylcholine promotes atherosclerosis[J]. Int J Mol Sci, 2021, 22(24): 13477.
31	TOYA T, CORBAN M T, MARRIETTA E, et al. Coronary artery disease is associated with an altered gut microbiome composition[J]. PLoS One, 2020, 15(1): e0227147.
32	LI Z H, WU Z Y, YAN J Y, et al. Gut microbe-derived metabolite trimethylamine N-oxide induces cardiac hypertrophy and fibrosis[J]. Lab Invest, 2019, 99(3): 346-357.
33	ZHAO M M, WEI H R, LI C Z, et al. Gut microbiota production of trimethyl-5-aminovaleric acid reduces fatty acid oxidation and accelerates cardiac hypertrophy[J]. Nat Commun, 2022, 13(1): 1757.
34	HEINEKE J, MOLKENTIN J D. Regulation of cardiac hypertrophy by intracellular signalling pathways[J]. Nat Rev Mol Cell Biol, 2006, 7(8): 589-600.
35	BILLET S, BARDIN S, VERP S, et al. Gain-of-function mutant of angiotensin Ⅱ receptor, type 1A, causes hypertension and cardiovascular fibrosis in mice[J]. J Clin Invest, 2007, 117(7): 1914-1925.
36	BOUTHIER J D, DE LUCA N, SAFAR M E, et al. Cardiac hypertrophy and arterial distensibility in essential hypertension[J]. Am Heart J, 1985, 109(6): 1345-1352.
37	SRIVASTAVA P M, CALAFIORE P, MACISAAC R J, et al. Prevalence and predictors of cardiac hypertrophy and dysfunction in patients with type 2 diabetes[J]. Clin Sci (Lond), 2008, 114(4): 313-320.
38	HU Q X, ZHANG H L, GUTIÉRREZ CORTÉS N, et al. Increased Drp1 acetylation by lipid overload induces cardiomyocyte death and heart dysfunction[J]. Circ Res, 2020, 126(4): 456-470.
39	RUBIN S A, FISHBEIN M C, SWAN H J. Compensatory hypertrophy in the heart after myocardial infarction in the rat[J]. J Am Coll Cardiol, 1983, 1(6): 1435-1441.
40	PFEFFER M A, BRAUNWALD E. Ventricular remodeling after myocardial infarction. Experimental observations and clinical implications[J]. Circulation, 1990, 81(4): 1161-1172.
41	EVERETT R J, TASTET L, CLAVEL M A, et al. Progression of hypertrophy and myocardial fibrosis in aortic stenosis: a multicenter cardiac magnetic resonance study[J]. Circ Cardiovasc Imaging, 2018, 11(6): e007451.

Gene	Forward primer	Reverse primer
Il-1β	GAAATGCCACCTTTTGACAGTG	TGGATGCTCTCATCAGGACAG
Il-17a	TTTAACTCCCTTGGCGCAAAA	CTTTCCCTCCGCATTGACAC
Il-6	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
Il-18	GACTCTTGCGTCAACTTCAAGG	CAGGCTGTCTTTTGTCAACGA
Ifn-γ	ATGAACGCTACACACTGCATC	CCATCCTTTTGCCAGTTCCTC
Ctgf	GGGCCTCTTCTGCGATTTC	ATCCAGGCAAGTGCATTGGTA
Col1a1	CTGGCGGTTCAGGTCCAAT	TTCCAGGCAATCCACGAGC
Col3a1	CTGTAACATGGAAACTGGGGAAA	CCATAGCTGAACTGAAAACCACC
Acta1	CCCAAAGCTAACCGGGAGAAG	CCAGAATCCAACACGATGCC
Nppa	GCTTCCAGGCCATATTGGAG	GGGGGCATGACCTCATCTT
β-Mhc	CGGACCTTGGAAGACCAGAT	GACAGCTCCCCATTCTCTGT
Gapdh	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA
β-actin	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT

Gene	Forward primer	Reverse primer
Il-1β	GAAATGCCACCTTTTGACAGTG	TGGATGCTCTCATCAGGACAG
Il-17a	TTTAACTCCCTTGGCGCAAAA	CTTTCCCTCCGCATTGACAC
Il-6	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
Il-18	GACTCTTGCGTCAACTTCAAGG	CAGGCTGTCTTTTGTCAACGA
Ifn-γ	ATGAACGCTACACACTGCATC	CCATCCTTTTGCCAGTTCCTC
Ctgf	GGGCCTCTTCTGCGATTTC	ATCCAGGCAAGTGCATTGGTA
Col1a1	CTGGCGGTTCAGGTCCAAT	TTCCAGGCAATCCACGAGC
Col3a1	CTGTAACATGGAAACTGGGGAAA	CCATAGCTGAACTGAAAACCACC
Acta1	CCCAAAGCTAACCGGGAGAAG	CCAGAATCCAACACGATGCC
Nppa	GCTTCCAGGCCATATTGGAG	GGGGGCATGACCTCATCTT
β-Mhc	CGGACCTTGGAAGACCAGAT	GACAGCTCCCCATTCTCTGT
Gapdh	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA
β-actin	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT

[1]	Ming-qi CAI, Yan CHEN, Kai-bin LIN, Dong HUANG. Advances in the role of growth differentiation factor 11 in cardiovascular diseases [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 834-838.
[2]	LIU Hua. Research development of cardiac remodeling in pregnancy [J]. , 2010, 30(4): 471-.