
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2024, Vol. 44 ›› Issue (9): 1069-1082.doi: 10.3969/j.issn.1674-8115.2024.09.002
• Basic research • Previous Articles Next Articles
CHEN Huaihuang(
), ZUO Wu(
), BIAN Qian(
)
Received:2024-05-03
Accepted:2024-05-22
Online:2024-09-28
Published:2024-09-28
Contact:
BIAN Qian
E-mail:chh1142268531@163.com;wuzuo@sjtu.edu.cn;qianbian@shsmu.edu.cn
Supported by:CLC Number:
CHEN Huaihuang, ZUO Wu, BIAN Qian. CTCF regulates lipid metabolism and gene expression in mouse AML12 liver cell line[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024,(9): 1069-1082.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2024.09.002
| Primer name | Sequence (5′→3′) |
|---|---|
| Mouse Ctcf-shRNA 1 | GGTGCAATTGAGAACATTATA CTCGAG TATAATGTTCTCAATTGCACC |
| Mouse Ctcf-shRNA 2 | TGGACGATACCCAGATCATAACTCGAGTTATGATCTGGGTATCGTCCA |
| Mouse scramble shRNA | TTCTCCGAACGTGTCACGT CTCGAG ACGTGACACGTTCGGAGAA |
Tab 1 shRNA sequences
| Primer name | Sequence (5′→3′) |
|---|---|
| Mouse Ctcf-shRNA 1 | GGTGCAATTGAGAACATTATA CTCGAG TATAATGTTCTCAATTGCACC |
| Mouse Ctcf-shRNA 2 | TGGACGATACCCAGATCATAACTCGAGTTATGATCTGGGTATCGTCCA |
| Mouse scramble shRNA | TTCTCCGAACGTGTCACGT CTCGAG ACGTGACACGTTCGGAGAA |
| Gene | Forward primer (5′→3′) | Reverse primer (5′→3′) |
|---|---|---|
| Ctcf | AACAGTGACCCTCCTGAGGAATC | TATAACGACGATGCCGCACCA |
| β-actin | CATTGCTGACAGGATGCAGAAGG | TGCTGGAAGGTGGACAGTGAGG |
Tab 2 Primer sequences for RT-qPCR
| Gene | Forward primer (5′→3′) | Reverse primer (5′→3′) |
|---|---|---|
| Ctcf | AACAGTGACCCTCCTGAGGAATC | TATAACGACGATGCCGCACCA |
| β-actin | CATTGCTGACAGGATGCAGAAGG | TGCTGGAAGGTGGACAGTGAGG |
| Gene | CTCF-associated gene | CTCF-non-associated gene |
|---|---|---|
| Downregulated gene | 338 | 276 |
| Unchanged gene | 5 323 | 4 921 |
| Upregulated gene | 461 | 269 |
Tab 3 Classification statistics of CTCF-associated and CTCF-non-associated genes
| Gene | CTCF-associated gene | CTCF-non-associated gene |
|---|---|---|
| Downregulated gene | 338 | 276 |
| Unchanged gene | 5 323 | 4 921 |
| Upregulated gene | 461 | 269 |
| Gene | CTCF up peak annotation | CTCF unchanged peak annotation | CTCF down peak annotation |
|---|---|---|---|
| Downregulated gene | 14 | 338 | 117 |
| Unchange gene | 294 | 5 323 | 1 803 |
| Upregualated gene | 48 | 461 | 158 |
Tab 4 Statistics of genes annotated with differential CTCF binding peaks and differentially expressed genes in AML12 cells
| Gene | CTCF up peak annotation | CTCF unchanged peak annotation | CTCF down peak annotation |
|---|---|---|---|
| Downregulated gene | 14 | 338 | 117 |
| Unchange gene | 294 | 5 323 | 1 803 |
| Upregualated gene | 48 | 461 | 158 |
| 1 | ARZATE-MEJÍA R G, RECILLAS-TARGA F, CORCES V G. Developing in 3D: the role of CTCF in cell differentiation[J]. Development, 2018, 145(6): dev137729. |
| 2 | KUBO N, ISHII H, XIONG X, et al. Promoter-proximal CTCF binding promotes distal enhancer-dependent gene activation[J]. Nat Struct Mol Biol, 2021, 28(2): 152-161. |
| 3 | LIU Y T, WAN X, LI H, et al. CTCF coordinates cell fate specification via orchestrating regulatory hubs with pioneer transcription factors[J]. Cell Rep, 2023, 42(10): 113259. |
| 4 | BISSERIER M, MATHIYALAGAN P, ZHANG S H, et al. Regulation of the methylation and expression levels of the BMPR2 gene by SIN3a as a novel therapeutic mechanism in pulmonary arterial hypertension[J]. Circulation, 2021, 144(1): 52-73. |
| 5 | NUEBLER J, FUDENBERG G, IMAKAEV M, et al. Chromatin organization by an interplay of loop extrusion and compartmental segregation[J]. Proc Natl Acad Sci U S A, 2018, 115(29): E6697-E6706. |
| 6 | XIANG J F, CORCES V G. Regulation of 3D chromatin organization by CTCF[J]. Curr Opin Genet Dev, 2021, 67: 33-40. |
| 7 | DAVIDSON I F, BARTH R, ZACZEK M, et al. CTCF is a DNA-tension-dependent barrier to cohesin-mediated loop extrusion[J]. Nature, 2023, 616(7958): 822-827. |
| 8 | ROWLEY M J, CORCES V G. Organizational principles of 3D genome architecture[J]. Nat Rev Genet, 2018, 19(12): 789-800. |
| 9 | DEHINGIA B, MILEWSKA M, JANOWSKI M, et al. CTCF shapes chromatin structure and gene expression in health and disease[J]. EMBO Rep, 2022, 23(9): e55146. |
| 10 | HYLE J, ZHANG Y, WRIGHT S, et al. Acute depletion of CTCF directly affects MYC regulation through loss of enhancer-promoter looping[J]. Nucleic Acids Res, 2019, 47(13): 6699-6713. |
| 11 | RAHME G J, JAVED N M, PUORRO K L, et al. Modeling epigenetic lesions that cause gliomas[J]. Cell, 2023, 186(17): 3674-3685.e14. |
| 12 | POULOS R C, THOMS J A I, GUAN Y F, et al. Functional mutations form at CTCF-cohesin binding sites in melanoma due to uneven nucleotide excision repair across the motif[J]. Cell Rep, 2016, 17(11): 2865-2872. |
| 13 | RIBEIRO DE ALMEIDA C, STADHOUDERS R, DE BRUIJN M J, et al. The DNA-binding protein CTCF limits proximal Vκ recombination and restricts κ enhancer interactions to the immunoglobulin κ light chain locus[J]. Immunity, 2011, 35(4): 501-513. |
| 14 | HIRAYAMA T, TARUSAWA E, YOSHIMURA Y, et al. CTCF is required for neural development and stochastic expression of clustered Pcdh genes in neurons[J]. Cell Rep, 2012, 2(2): 345-357. |
| 15 | CHRISTOV M, CLARK A R, CORBIN B, et al. Inducible podocyte-specific deletion of CTCF drives progressive kidney disease and bone abnormalities[J]. JCI Insight, 2018, 3(4): e95091. |
| 16 | GOMEZ-VELAZQUEZ M, BADIA-CAREAGA C, LECHUGA-VIECO A V, et al. CTCF counter-regulates cardiomyocyte development and maturation programs in the embryonic heart[J]. PLoS Genet, 2017, 13(8): e1006985. |
| 17 | DUBOIS-CHEVALIER J, OGER F, DEHONDT H, et al. A dynamic CTCF chromatin binding landscape promotes DNA hydroxymethylation and transcriptional induction of adipocyte differentiation[J]. Nucleic Acids Res, 2014, 42(17): 10943-10959. |
| 18 | WANG R R, QIU X Y, PAN R, et al. Dietary intervention preserves β cell function in mice through CTCF-mediated transcriptional reprogramming[J]. J Exp Med, 2022, 219(7): e20211779. |
| 19 | CHOI Y, SONG M J, JUNG W J, et al. Liver-specific deletion of mouse CTCF leads to hepatic steatosis via augmented PPARγ signaling[J]. Cell Mol Gastroenterol Hepatol, 2021, 12(5): 1761-1787. |
| 20 | WANG W, REN G, HONG N, et al. Exploring the changing landscape of cell-to-cell variation after CTCF knockdown via single cell RNA-seq[J]. BMC Genomics, 2019, 20(1): 1015. |
| 21 | PINTO P B, DOMSCH K, LOHMANN I. Hox function and specificity: a tissue centric view[J]. Semin Cell Dev Biol, 2024, 152/153: 35-43. |
| 22 | AITKEN S J, IBARRA-SORIA X, KENTEPOZIDOU E, et al. CTCF maintains regulatory homeostasis of cancer pathways[J]. Genome Biol, 2018, 19(1): 106. |
| 23 | DAVIDSON I F, PETERS J M. Genome folding through loop extrusion by SMC complexes[J]. Nat Rev Mol Cell Biol, 2021, 22(7): 445-464. |
| [1] | Lin Xuefeng, Lai Dongmei. Research progress in the impact of elevated follicle-stimulating hormone levels on metabolic changes in postmenopausal women [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(7): 990-996. |
| [2] | Li Bei, Li Jingchen, Guo Xilang, Yu Yuansidu, Luo Yihong, Hu Qin, Gao Li. Review of circadian rhythm mechanism of lipid metabolism and its impact on the incidence of stroke [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(5): 672-679. |
| [3] | Wang Li, Song Kang. Progress in the mechanism of the effects of antihyperglycemic agents on lipid metabolism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(5): 680-687. |
| [4] | ZHU Zijun, QIAN Yife, LI Qianyu, LI Songling, QIN Wenli, LIU Yanfeng. Anaphase-promoting complex subunit 10 promotes hepatocellular carcinoma progression through regulation of the PI3K-AKT-mTOR signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1171-1182. |
| [5] | WANG Renjie, HUA Hui, ZHU ChaoYu, WEI Li. Advances of GADD45b in hepatic glucose and lipid metabolism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(10): 1316-1322. |
| [6] | JIANG Quanxin, CHEN Suzhen, LIU Junli. Research progress in ceruloplasmin regulation of lipid metabolism homeostasis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(1): 124-130. |
| [7] | WANG Jie, WU Hui, LU Lingpeng, YANG Kefeng, ZHU Jie, ZHOU Hengyi, YAO Die, GAO Ya, FENG Yuting, LIU Yuhong, JIA Jie. Dynamic changes in gut microbiota of women with gestational diabetes mellitus and the correlation with blood glucose, blood lipid and diet [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1336-1346. |
| [8] | HU Chanchan, FAN Yi, XU Yuan, HU Zhijian, ZENG Yiming. Lipid metabolism and lung cancer: emerging roles in occurrence, progression, diagnosis and treatment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(12): 1766-1771. |
| [9] | Jiang YUE, Yong ZHOU, Hua XU, Wen LIU, Xiao-feng HAN, Qing MAO, Ji-dong ZHANG, Jing MA, Han-dong JIANG, Wei LIU. Characteristic analysis and comparison of glycolipid metabolism in patients with coronavirus disease 2019 in common condition and severe cases [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(3): 355-359. |
| [10] | Zhuo-yi YANG, Hui CHEN, Si-yi BAI, Pameila PERHATI, Jing-li HOU, Yun-sheng YUAN. Phosphoproteomic analysis of concanavalin A-induced hepatocytes injury [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(1): 1-7. |
| [11] | PENG Rong, YANG Li-jun, DENG Mao-lin. Effects of low-carbohydrate diet on body weight and glycolipid metabolism in normal rats and obese rats [J]. , 2020, 40(1): 44-. |
| [12] | YE Hua-ying1, 2, LI Hua-ping2. Correlation analysis of plasma lipid with glucose status and insulin resistance in pregnant women with gestational diabetes mellitus [J]. , 2019, 39(7): 768-. |
| [13] | ZHAO Ming-liang1, 2, ZHAO Ai-hua1, ZHENG Xiao-jiao1, JIA Wei1. Role of farnesol X receptor in glycolipid metabolism regulation [J]. , 2019, 39(6): 671-. |
| [14] | SUI Chun-hua, LU Ying-li, GUO Yu-yu. Effects of GLP-1 analogues on kidney function and kidney ultrastructure in type 2 diabetic rats [J]. , 2018, 38(1): 48-. |
| [15] | FENG Sui-bin, LIU Hai-jun, ZHOU Zhou, WANG Xiao, HU Cheng, ZHANG Xue-li1. Effect of Roux-en-Y gastric bypass surgery on hepatic glucolipid metabolism in rats with obesity combined with type 2 diabetes mellitus#br# [J]. , 2017, 37(9): 1201-. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||