Anaphase-promoting complex subunit 10 promotes hepatocellular carcinoma progression through regulation of the PI3K-AKT-mTOR signaling pathway

doi:10.3969/j.issn.1674-8115.2025.09.009

Abstract

Abstract:

Objective ·To explore the biological functions and underlying mechanisms of anaphase-promoting complex subunit 10 (ANAPC10) in the development and progression of liver hepatocellular carcinoma (LIHC, often abbreviated as HCC). Methods ·By integrating data from The Cancer Genome Atlas (TCGA)_LIHC, the hepatitis B virus-related subgroup (HBV) of the China Hepatocellular Carcinoma Genome Project (CHCC), and the Gene Expression Omnibus (GEO), the expression pattern of ANAPC10 in HCC was analyzed. Western blotting and quantitative real-time PCR (q-PCR) were used to verify the findings in HCC cell lines. shRNA-mediated knockdown of ANAPC10 was performed in MHCC-97H and SNU-398 cell lines to investigate the effect of ANAPC10 depletion on the in vitro proliferation of HCC cells. An orthotopic liver cancer model with Anapc10 knockout was constructed using the hydrodynamic tail-vein injection technique in mice to further confirm the impact of ANAPC10 deficiency in the liver on the development and progression of HCC. Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) enrichment analyses were performed on the RNA-sequencing data from TCGA_LIHC and CHCC_HBV. Results ·ANAPC10 was highly expressed in tumor tissues, and its expression level was closely related to patient survival. Downregulation of ANAPC10 in vitro and in vivo effectively inhibited HCC progression. ANAPC10 mainly reprogrammed the metabolism of tumors by affecting the PI3K-AKT-mTOR pathway. In the tumor tissues of the orthotopic liver cancer mouse model in the Anapc10 knockout group, the phosphorylation levels of Akt and S6k were decreased, and changes in the key downstream lipid metabolism proteins Fasn and Scd1 were verified. Conclusion ·ANAPC10 is highly expressed in HCC and is positively correlated with poor prognosis. It promotes HCC occurrence and progression by activating the PI3K-AKT-mTOR signaling pathway and enhancing lipid metabolism reprogramming, thereby promoting tumor cell proliferation. These findings expand the understanding of ANAPC10 in tumor progression and suggest potential therapeutic targets for HCC.

Key words: anaphase-promoting complex subunit 10 (ANAPC10), hepatocellular carcinoma (HCC), PI3K-AKT-mTOR pathway, lipid metabolism reprogramming, cell proliferation

CLC Number:

R735.7

ZHU Zijun, QIAN Yife, LI Qianyu, LI Songling, QIN Wenli, LIU Yanfeng. Anaphase-promoting complex subunit 10 promotes hepatocellular carcinoma progression through regulation of the PI3K-AKT-mTOR signaling pathway[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1171-1182.

Figures/Tables 6

Tab 1 shRNA sequences （5'→3'）

shRNA	Target sequence (5'→3')	Loop sequence
shANAPC10-1	CAGTCAGAGTAGGAAATAATT	CTCGAG
shANAPC10-2	GACAATCATAAGAAGCCAACT	CTCGAG

Tab 2 sgRNA sequences （5'→3'）

sgRNA	Forward (5'→3')	Reverse (5'→3')
sgAnacp10-1	CACCAATCCGGCAACTTGAATTGG	AAACCCAATTCAAGTTGCCGGATT
sgAnacp10-2	CACCGCAACTTGAATTGGTGGAAC	AAACGTTCCACCAATTCAAGTTGC
sgAnacp10-3	CACCAGAAATCCGGCAACTTGA	AAACTCAAGTTGCCGGATTTCT

Fig 1 Expression of ANAPC10 in hepatocellular carcinoma and its association with patient survival

Fig 2 Proliferation of tumor cells with ANAPC10 knockdown and HCC formation in Anapc10 knockout mice

Fig 3 Pathway enrichment analysis associated with ANAPC10 expression and WB/IHC validation in stable cell lines and mouse liver cancer tissues

Fig 4 WB and IHC validation of key lipid metabolism proteins in stable cell lines and murine hepatocellular carcinoma tissues

TrendMD

References 25

[1]	BRAY F, LAVERSANNE M, SUNG H, et al. Global cancer statistics 2022: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2024, 74(3): 229-263.
[2]	MCGLYNN K A, PETRICK J L, THOMAS LONDON W. Global epidemiology of hepatocellular carcinoma: an emphasis on demographic and regional variability[J]. Clin Liver Dis, 2015, 19(2): 223-238.
[3]	ALLEMANI C, MATSUDA T, DI CARLO V, et al. Global surveillance of trends in cancer survival 2000-14 (CONCORD-3): analysis of individual records for 37 513 025 patients diagnosed with one of 18 cancers from 322 population-based registries in 71 countries[J]. Lancet, 2018, 391(10125): 1023-1075.
[4]	LLOVET J M, KELLEY R K, VILLANUEVA A, et al. Hepatocellular carcinoma[J]. Nat Rev Dis Primers, 2021, 7(1): 6.
[5]	BERTUCCIO P, TURATI F, CARIOLI G, et al. Global trends and predictions in hepatocellular carcinoma mortality[J]. J Hepatol, 2017, 67(2): 302-309.
[6]	SUNG H, FERLAY J, SIEGEL R L, et al. Global cancer statistics 2020: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-249.
[7]	SINGAL A G, LAMPERTICO P, NAHON P. Epidemiology and surveillance for hepatocellular carcinoma: new trends[J]. J Hepatol, 2020, 72(2): 250-261.
[8]	CHEN J G, EGNER P A, NG D, et al. Reduced aflatoxin exposure presages decline in liver cancer mortality in an endemic region of China[J]. Cancer Prev Res (Phila), 2013, 6(10): 1038-1045.
[9]	HUANG D Q, EL-SERAG H B, LOOMBA R. Global epidemiology of NAFLD-related HCC: trends, predictions, risk factors and prevention[J]. Nat Rev Gastroenterol Hepatol, 2021, 18(4): 223-238.
[10]	KOH J H, WANG M, SUZUKI H, et al. NAFLD and NAFLD-related HCC in Asia: burden and surveillance[J]. J Clin Exp Hepatol, 2024, 14(1): 101213.
[11]	HUANG D Q, SINGAL A G, KONO Y, et al. Changing global epidemiology of liver cancer from 2010 to 2019: Nash is the fastest growing cause of liver cancer[J]. Cell Metab, 2022, 34(7): 969-977.e2.
[12]	ZHOU J, SUN H C, WANG Z, et al. Guidelines for the diagnosis and treatment of hepatocellular carcinoma (2019 edition)[J]. Liver Cancer, 2020, 9(6): 682-720.
[13]	YAN K, DONG W, LI X W, et al. Early explosive recurrence of hepatocellular carcinoma after radical resection: risk factors and clinical significance[J]. Cancer Screen Prev, 2023, 2(4): 238-249.
[14]	POON R T, FAN S T. Evaluation of the new AJCC/UICC staging system for hepatocellular carcinoma after hepatic resection in Chinese patients[J]. Surg Oncol Clin N Am, 2003, 12(1): 35-50, viii.
[15]	LLOVET J M, RICCI S, MAZZAFERRO V, et al. Sorafenib in advanced hepatocellular carcinoma[J]. N Engl J Med, 2008, 359(4): 378-390.
[16]	KUDO M, FINN R S, QIN S K, et al. Lenvatinib versus sorafenib in first-line treatment of patients with unresectable hepatocellular carcinoma: a randomised phase 3 non-inferiority trial[J]. Lancet, 2018, 391(10126): 1163-1173.
[17]	BRUIX J, QIN S K, MERLE P, et al. Regorafenib for patients with hepatocellular carcinoma who progressed on sorafenib treatment (RESORCE): a randomised, double-blind, placebo-controlled, phase 3 trial[J]. Lancet, 2017, 389(10064): 56-66.
[18]	ZHU A X, FINN R S, EDELINE J, et al. Pembrolizumab in patients with advanced hepatocellular carcinoma previously treated with sorafenib (KEYNOTE-224): a non-randomised, open-label phase 2 trial[J]. Lancet Oncol, 2018, 19(7): 940-952.
[19]	FINN R S, QIN S K, IKEDA M, et al. Atezolizumab plus bevacizumab in unresectable hepatocellular carcinoma[J]. N Engl J Med, 2020, 382(20): 1894-1905.
[20]	BARFORD D. Structure, function and mechanism of the anaphase promoting complex (APC/C)[J]. Q Rev Biophys, 2011, 44(2): 153-190.
[21]	HUANG S Y, WAN P, HUANG S Y, et al. The APC10 subunit of the anaphase-promoting complex/cyclosome orchestrates NLRP3 inflammasome activation during the cell cycle[J]. FEBS Lett, 2021, 595(19): 2463-2478.
[22]	WANG Y N, HAN T Y, GAN M X, et al. A novel function of anaphase promoting complex subunit 10 in tumor progression in non-small cell lung cancer[J]. Cell Cycle, 2019, 18(9): 1019-1032.
[23]	FAN H M, QUAN S X, YE Q, et al. A molecular framework underlying low-nitrogen-induced early leaf senescence in Arabidopsis thaliana[J]. Mol Plant, 2023, 16(4): 756-774.
[24]	GROSSBERGER R, GIEFFERS C, ZACHARIAE W, et al. Characterization of the DOC1/APC10 subunit of the yeast and the human anaphase-promoting complex[J]. J Biol Chem, 1999, 274(20): 14500-14507.
[25]	CARROLL C W, MORGAN D O. The Doc1 subunit is a processivity factor for the anaphase-promoting complex[J]. Nat Cell Biol, 2002, 4(11): 880-887.