Mechanism of Fas-associated protein with death domain in promoting proliferation of head and neck squamous cell carcinoma cells

doi:10.3969/j.issn.1674-8115.2025.04.002

Abstract

Abstract:

Objective ·To detect the expression level of Fas-associated protein with death domain (FADD) in head and neck squamous cell carcinoma (HNSCC) and to explore the molecular mechanisms by which FADD promotes the proliferation of HNSCC cells. Methods ·The GEPIA 2 database was utilized to analyze the expression level of FADD in tumor tissues and to evaluate its association with prognosis. Immunohistochemistry staining (IHC) was performed on HNSCC tissues to investigate the changes in FADDexpression levels in normal, dysplastic, and tumor tissues. Stable FADD-knockdown Fadu and HSC3 cell lines were constructed and validated using Western blotting and quantitative real-time PCR (qRT-PCR). The regulatory effect of FADD on the proliferation of HNSCC cells was explored using the LiveCyte live-cell tracking system, colony formation assay, and cell viability assay. Proteins interacting with FADD were identified by co-immunoprecipitation mass spectrometry (Co-IP/MS), and further mechanistic studies were conducted using CRISPR/Cas9 technology, LiveCyte live-cell tracking system, and Western blotting. Results ·Analysis of the GEPIA2 database indicated that FADD was significantly overexpressed in head and neck cancer and was associated with poor prognosis. IHC staining showed that FADD expression levels progressively increased from normal to dysplastic to tumor tissues in HNSCC patients. Knockdown of FADD in HNSCC cells resulted in significantly reduced proliferation and colony formation compared to the control group. Co-IP/MS results showed that FADD interacted with the CUX1 protein, and FADD knockdown led to increased CUX1 expression. Moreover, CUX1 knockdown significantly promoted HNSCC cell proliferation and reversed the anti-proliferative phenotype caused by FADD knockdown. Conclusion ·FADD plays a significant pro-carcinogenic role in HNSCC and is associated with poor prognosis. FADD can further regulate tumor cell proliferation by interacting with CUX1 and suppressing its expression level.

Key words: Fas-associated protein with death domain (FADD), CUT-like homeobox 1 (CUX1), head and neck squamous cell carcinoma (HNSCC), cell proliferation

CLC Number:

R730.261

CHEN Yinan, ZHENG Yang, ZENG Hanlin, LEI Ming. Mechanism of Fas-associated protein with death domain in promoting proliferation of head and neck squamous cell carcinoma cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(4): 404-414.

Figures/Tables 7

TrendMD

References 32

1	SUNG H, FERLAY J, SIEGEL R L, et al. Global cancer statistics 2020: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-249.
2	SUN Z, SUN X D, CHEN Z W, et al. Head and neck squamous cell carcinoma: risk factors, molecular alterations, immunology and peptide vaccines[J]. Int J Pept Res Ther, 2022, 28(1): 19.
3	WITTEKINDT C, WAGNER S, SHARMA S, et al. HPV-das andere kopf-Hals-karzinom[J]. Laryngo-Rhino-Otologie, 2018, 97(S 01): S48-S113.
4	WONG K C W, JOHNSON D, HUI E P, et al. Opportunities and challenges in combining immunotherapy and radiotherapy in head and neck cancers[J]. Cancer Treat Rev, 2022, 105: 102361.
5	RENÉ LEEMANS C, SNIJDERS P J F, BRAKENHOFF R H. The molecular landscape of head and neck cancer[J]. Nat Rev Cancer, 2018, 18(5): 269-282.
6	BHAT G R, HYOLE R G, LI J. Head and neck cancer: current challenges and future perspectives[J]. Adv Cancer Res, 2021, 152: 67-102.
7	TOURNEUR L, CHIOCCHIA G. FADD: a regulator of life and death[J]. Trends Immunol, 2010, 31(7): 260-269.
8	LEE E W, SEO J, JEONG M, et al. The roles of FADD in extrinsic apoptosis and necroptosis[J]. BMB Rep, 2012, 45(9): 496-508.
9	LIU Y, LI X G, ZHOU X H, et al. FADD as a key molecular player in cancer progression[J]. Mol Med, 2022, 28(1): 132.
10	AWADIA S, SITTO M, RAM S, et al. The adapter protein FADD provides an alternate pathway for entry into the cell cycle by regulating APC/C-Cdh1 E3 ubiquitin ligase activity[J]. J Biol Chem, 2023, 299(6): 104786.
11	PATTJE W J, MELCHERS L J, SLAGTER-MENKEMA L, et al. FADD expression is associated with regional and distant metastasis in squamous cell carcinoma of the head and neck[J]. Histopathology, 2013, 63(2): 263-270.
12	WEI S Y, CHEN Z G, LING X Y, et al. Comprehensive analysis illustrating the role of PANoptosis-related genes in lung cancer based on bioinformatic algorithms and experiments[J]. Front Pharmacol, 2023, 14: 1115221.
13	MARÍN-RUBIO J L, PÉREZ-GÓMEZ E, FERNÁNDEZ-PIQUERAS J, et al. S194-P-FADD as a marker of aggressiveness and poor prognosis in human T-cell lymphoblastic lymphoma[J]. Carcinogenesis, 2019, 40(10): 1260-1268.
14	ZHANG R, LIU Y T, HAMMACHE K, et al. The role of FADD in pancreatic cancer cell proliferation and drug resistance[J]. Oncol Lett, 2017, 13(3): 1899-1904.
15	ZHENG Y, SHENG S, MA Y, et al. FADD amplification is associated with CD8⁺ T-cell exclusion and malignant progression in HNSCC[J]. Oral Dis, 2024, 30(8): 5007-5021.
16	HE M, HE Y Y, XU J, et al. Upregulated FADD is associated with poor prognosis, immune exhaustion, tumor malignancy, and immunotherapy resistance in patients with lung adenocarcinoma[J]. Front Oncol, 2023, 13: 1228889.
17	XUE T, YAN R, LI Z S, et al. Prognostic significance and immune correlates of FADD in penile squamous cell carcinoma[J]. Virchows Arch, 2023, 482(5): 869-878.
18	CIMINO Y, COSTES A, DAMOTTE D, et al. FADD protein release mirrors the development and aggressiveness of human non-small cell lung cancer[J]. Br J Cancer, 2012, 106(12): 1989-1996.
19	LIVINGSTON S, CARLTON C, SHARMA M, et al. Cux1 regulation of the cyclin kinase inhibitor p27^kip1 in polycystic kidney disease is attenuated by HDAC inhibitors[J]. Gene X, 2019, 2: 100007.
20	RAMDZAN Z M, NEPVEU A. CUX1 a haploinsufficient tumour suppressor gene overexpressed in advanced cancers[J]. Nat Rev Cancer, 2014, 14(10): 673-682.
21	WELZ P S, WULLAERT A, VLANTIS K, et al. FADD prevents RIP3-mediated epithelial cell necrosis and chronic intestinal inflammation[J]. Nature, 2011, 477(7364): 330-334.
22	ITOH N, YONEHARA S, ISHII A, et al. The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis[J]. Cell, 1991, 66(2): 233-243.
23	TARTAGLIA L A, AYRES T M, WONG G H, et al. A novel domain within the 55 kd TNF receptor signals cell death[J]. Cell, 1993, 74(5): 845-853.
24	LOS M, VAN DE CRAEN M, PENNING L C, et al. Requirement of an ICE/CED-3 protease for fas/APO-1-mediated apoptosis[J]. Nature, 1995, 375(6526): 81-83.
25	STANIEK J, KALINA T, ANDRIEUX G, et al. Non-apoptotic FAS signaling controls mTOR activation and extrafollicular maturation in human B cells[J]. Sci Immunol, 2024, 9(91): eadj5948.
26	LIU Y B, FAN C X, ZHANG Y F, et al. RIP1 kinase activity-dependent roles in embryonic development of Fadd-deficient mice[J]. Cell Death Differ, 2017, 24(8): 1459-1469.
27	CHEN G A, BHOJANI M S, HEAFORD A C, et al. Phosphorylated FADD induces NF-kappaB, perturbs cell cycle, and is associated with poor outcome in lung adenocarcinomas[J]. Proc Natl Acad Sci USA, 2005, 102(35): 12507-12512.
28	GONZÁLEZ-MOLES M Á, AYÉN Á, GONZÁLEZ-RUIZ I, et al. Prognostic and clinicopathological significance of FADD upregulation in head and neck squamous cell carcinoma: a systematic review and meta-analysis[J]. Cancers, 2020, 12(9): 2393.
29	EYTAN D F, SNOW G E, CARLSON S, et al. SMAC mimetic birinapant plus radiation eradicates human head and neck cancers with genomic amplifications of cell death genes FADD and BIRC2[J]. Cancer Res, 2016, 76(18): 5442-5454.
30	CHIEN H T, CHENG S D, CHUANG W Y, et al. Clinical Implications of FADD Gene Amplification and Protein Overexpression in Taiwanese Oral Cavity Squamous Cell Carcinomas[J]. PLOS One, 2016, 11(10): e0164870.
31	SUPPER E, RUDAT S, IYER V, et al. Cut-like homeobox 1 (CUX1) tumor suppressor gene haploinsufficiency induces apoptosis evasion to sustain myeloid leukemia[J]. Nat Commun, 2021, 12(1): 2482.
32	LIU N, SUN Q L, WAN L, et al. CUX1, A controversial player in tumor development[J]. Front Oncol, 2020, 10: 738.

Name	Sequence (5′→3′)
shCON-F	CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTTG
shCON-R	AATTCAAAAAACCTAAGGTTAAGTCGCCCTCG CTCGAGCGAGGGCGACTTAACCTTAGG
shFADD-1-F	CCGGGTGCAGCATTTAACGTCATATCTCGAG ATATGACGTTAAATGCTGCACTTTTTTG
shFADD-1-R	AATTCAAAAAAGTGCAGCATTTAACGTCATATCTCGAGATATGACGTTAAATGCTGCAC
shFADD-2-F	CCGGGCTGACCTGGTACAAGAGGTTCTCGAGAACCTCTTGTACCAGGTCAGCTTTTTTG
shFADD-2-R	AATTCAAAAAAGCTGACCTGGTACAAGAGGTT CTCGAGAACCTCTTGTACCAGGTCAGC
shFADD-3-F	CCGGCATGGAACTCAGACGCATCTACTCGAGTAGATGCGTCTGAGTTCCATGTTTTTTG
shFADD-3-R	AATTCAAAAAACATGGAACTCAGACGCATCTACTCGAGTAGATGCGTCTGAGTTCCATG
sgCUX1-F	CACCGCCGGTTCGCCAATACCGTTG
sgCUX1-R	AAACCAACGGTATTGGCGAACCGGC

Name	Sequence (5′→3′)
shCON-F	CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTTG
shCON-R	AATTCAAAAAACCTAAGGTTAAGTCGCCCTCG CTCGAGCGAGGGCGACTTAACCTTAGG
shFADD-1-F	CCGGGTGCAGCATTTAACGTCATATCTCGAG ATATGACGTTAAATGCTGCACTTTTTTG
shFADD-1-R	AATTCAAAAAAGTGCAGCATTTAACGTCATATCTCGAGATATGACGTTAAATGCTGCAC
shFADD-2-F	CCGGGCTGACCTGGTACAAGAGGTTCTCGAGAACCTCTTGTACCAGGTCAGCTTTTTTG
shFADD-2-R	AATTCAAAAAAGCTGACCTGGTACAAGAGGTT CTCGAGAACCTCTTGTACCAGGTCAGC
shFADD-3-F	CCGGCATGGAACTCAGACGCATCTACTCGAGTAGATGCGTCTGAGTTCCATGTTTTTTG
shFADD-3-R	AATTCAAAAAACATGGAACTCAGACGCATCTACTCGAGTAGATGCGTCTGAGTTCCATG
sgCUX1-F	CACCGCCGGTTCGCCAATACCGTTG
sgCUX1-R	AAACCAACGGTATTGGCGAACCGGC

Name	Sequence (5′→3′)
Homo-FADD-mRNA-F	GTGGCTGACCTGGTACAAGAG
Homo-FADD-mRNA-R	GGTAGATGCGTCTGAGTTCCAT

Name	Sequence (5′→3′)
Homo-FADD-mRNA-F	GTGGCTGACCTGGTACAAGAG
Homo-FADD-mRNA-R	GGTAGATGCGTCTGAGTTCCAT

[1]	LI Xiang, WEI Ming, WU Wenxi, LUO Xiaoqin, YAO Biao, WU Siyu. Inhibitory effect of rutin on the growth and metastasis of osteosarcoma in vitro and in vivo [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 20-28.
[2]	SUN Chenwei, HAI Wangxi, QU Qian, XI Yun. [¹⁸F]F-FMISO and [¹⁸F]F-FLT PET/CT dual-nuclide imaging for in vivo prediction of drug resistance in pancreatic cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 60-68.
[3]	SHI Lingling, CHENG Yanyong, ZHANG Lei. Effects of sevoflurane exposure on proliferation and differentiation of primary oligodendrocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1115-1123.
[4]	TAN Lu, SHEN Shaoming, HE Ping. Function and mechanism study of hypoxia-induced long non-coding RNA 68 in hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(6): 702-712.
[5]	CAI Renjie, XU Ming. KHSRP regulates the responsiveness of prostate cancer cells to androgens through ANK3 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 417-426.
[6]	AN Junyi, CHEN Biying, CHEN Xunrui, YIN Shanshan, BIAN Zhouliang, LIU Feng. SFXN3 expression in head and neck squamous cell carcinoma and its effect on cell proliferation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 427-434.
[7]	LI Huxiao, LI Xiaotian, ZHAO Xuri, ZHANG Huanyu, ZHOU Wei, SONG Zhongchen. Effects of gingipain extract on the biological characteristics of oral squamous cell carcinoma cell HN6 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 161-168.
[8]	LUO Lange, ZHENG Chao, LEI Ming. Promotive effect of cancer-testis antigen CT57 on proliferation, invasion, migration and epithelial-mesenchymal transition of liver cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1335-1346.
[9]	KONG Ruxin, ZHOU Yaqun, WEI Tingyi, LEI Ming. Function and mechanism of cancer-testis antigen CT63 in chronic myeloid leukemia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1347-1358.
[10]	GAO Kexing, LIAO Chunhua, LI Shengze, MA Shuangyu, HUANG Lei. Functional site analysis of mucin 1 in regulating the malignant characteristics of tumor cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1370-1382.
[11]	CHEN Jin, FU Yao. Research progress in autologous regeneration of human corneal endothelial cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 775-780.
[12]	YANG Wanli, SONG Juan, LI Bing, LAO Yimin. Deciphering the suppressive effects of CBX8 on prostate cancer cell invasion [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1507-1519.
[13]	DING He, CAO Yanglin, HE Yang, WEI Xing, YANG Jianfeng. SMAD7 expression in multiple myeloma and its effect on cell proliferation and drug resistance [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 858-865.
[14]	HU Zhexuan, ZHANG Xin, WO Lulu, LI Jingchi, WANG Jiao, ZHOU Cixiang, ZHAO Qian. Study on the function of TRMT61A in liver cancer cell and its mechanism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 742-750.
[15]	XU Feixiang, WANG Sheng, XUE Mingming, TONG Chaoyang, CHEN Yumei. Effect of altered expression of long non-coding RNA-B230352I09 on proliferation and cycle of H9C2 cardiomyocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 578-582.