Function and mechanism of cancer-testis antigen CT63 in chronic myeloid leukemia

doi:10.3969/j.issn.1674-8115.2024.11.002

Abstract

Abstract:

Objective ·To explore the effects of the cancer-testis antigen (CTA) family member CT63 on proliferation, differentiation, and tumorigenicity of chronic myeloid leukemia (CML) cells, and uncover the underlying molecular mechanisms. Methods ·The link between CT63 expression and the prognosis of myeloid leukemia patients was analyzed using bioinformatics methods (TCGA database). A K562 cell line with CT63 knockdown was established. The knockdown efficiency of CT63 was confirmed by qRT-PCR and Western blotting. Live-cell imaging and CCK-8 methods were adopted to evaluate the inhibitory effect of CT63 knockdown in CML cells. A subcutaneous tumorigenesis assay in nude mice was conducted to examine the effects of CT63 on tumorigenesis, tumor growth, and differentiation of K562 cells invivo. Phorbol 12-myristate 13-acetate (PMA)-induced monocyte/macrophage differentiation experiment was carried out to investigate the role of CT63 in the differentiation of K562 cells in vitro. Mitochondrial function was assessed to determine the impact of CT63 on CML cells both in vivo and in vitro. Results ·The Kaplan-Meier survival curve indicated that low expression levels of CT63 were correlated with longer survival in patients with myeloid leukemia. Down-regulation of CT63 in K562 cells inhibited proliferation and promoted differentiation. Live-cell imaging and CCK-8 assays displayed that knockdown of CT63 inhibited cell proliferation and extended cell doubling time in K562 cells. In the subcutaneous xenotransplantation model, down-regulation of CT63 inhibited tumor growth in nude mice. K562 cells expressing lower levels of CT63 were more prone to differentiate into monocyte/macrophage both in vivo and in vitro under PMA exposure condition. Knockdown of CT63 suppressed the activity of mitochondrial respiratory chain complex Ⅳ. This led to decreased expression of mitochondrial markers, including cytochrome C oxidase Ⅳ (COX Ⅳ), pyruvate dehydrogenase, succinate dehydrogenase A (SDHA), and voltage-dependent anion channel (VDAC), thus affecting the mitochondrial metabolic activity of K562 cells. Conclusion ·CT63 is related to the prognosis of myeloid leukemia patients. CT63 plays an important role in promoting proliferation and inhibiting differentiation of K562 cells in vivo and in vitro. CT63 serves as a switch to regulate the balance between proliferation and differentiation of CML cells via the modulation of mitochondrial activity.

Key words: cancer-testis antigen 63, chronic myeloid leukemia, cell proliferation, cell differentiation, mitochondria

CLC Number:

R733.72

KONG Ruxin, ZHOU Yaqun, WEI Tingyi, LEI Ming. Function and mechanism of cancer-testis antigen CT63 in chronic myeloid leukemia[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1347-1358.

Figures/Tables 7

TrendMD

References 16

1	ARBER D A, ORAZI A, HASSERJIAN R, et al. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia[J]. Blood, 2016, 127(20): 2391-2405.
2	DEININGER M, BUCHDUNGER E, DRUKER B J. The development of imatinib as a therapeutic agent for chronic myeloid leukemia[J]. Blood, 2005, 105(7): 2640-2653.
3	PFIRRMANN M, BACCARANI M, SAUSSELE S, et al. Prognosis of long-term survival considering disease-specific death in patients with chronic myeloid leukemia[J]. Leukemia, 2016, 30(1): 48-56.
4	KOÇKAN B, TOPTAŞ T, ATAGÜNDÜZ I, et al. Molecular screening and the clinical impacts of BCR-ABL KD mutations in patients with imatinib-resistant chronic myeloid leukemia[J]. Oncol Lett, 2018, 15(2): 2419-2424.
5	OLD L J. Cancer/testis (CT) antigens: a new link between gametogenesis and cancer[J]. Cancer Immun, 2001, 1: 1.
6	WANG C, GU Y Y, ZHANG K, et al. Systematic identification of genes with a cancer-testis expression pattern in 19 cancer types[J]. Nat Commun, 2016, 7: 10499.
7	BHARDWAJ N, FRIEDLANDER P A, PAVLICK A C, et al. Flt3 ligand augments immune responses to anti-DEC-205-NY-ESO-1 vaccine through expansion of dendritic cell subsets[J]. Nat Cancer, 2020, 1(12): 1204-1217.
8	LIGGINS A P, BROWN P J, ASKER K, et al. A novel diffuse large B-cell lymphoma-associated cancer testis antigen encoding a PAS domain protein[J]. Br J Cancer, 2004, 91(1): 141-149.
9	GUINN B A, BLAND E A, LODI U, et al. Humoral detection of leukaemia-associated antigens in presentation acute myeloid leukaemia[J]. Biochem Biophys Res Commun, 2005, 335(4): 1293-1304.
10	LI R, GUO M, SONG L. PAS domain containing repressor 1 (PASD1) promotes glioma cell proliferation through inhibiting apoptosis in vitro[J]. Med Sci Monit, 2019, 25: 6955-6964.
11	SUKOR N F, YAHAYA A, SAGAP I, et al. Cancer testis antigen PASD1 expression and immunogenicity in human colorectal cancer and polyps[J]. Turk J Biol, 2022, 46(5): 361-374.
12	CORREIA-MELO C, ICHIM G, TAIT S W G, et al. Depletion of mitochondria in mammalian cells through enforced mitophagy[J]. Nat Protoc, 2017, 12: 183-194.
13	GOLDMAN J M, BAUGHAN A S, MCCARTHY D M, et al. Marrow transplantation for patients in the chronic phase of chronic granulocytic leukaemia[J]. Lancet, 1982, 2(8299): 623-625.
14	AIT-TAHAR K, LIGGINS A P, COLLINS G P, et al. Cytolytic T-cell response to the PASD1 cancer testis antigen in patients with diffuse large B-cell lymphoma[J]. Br J Haematol, 2009, 146(4): 396-407.
15	JOSEPH-PIETRAS D, GAO Y, ZOJER N, et al. DNA vaccines to target the cancer testis antigen PASD1 in human multiple myeloma[J]. Leukemia, 2010, 24(11): 1951-1959.
16	SHELLY C, PETRUZZELLI L, HERRERA R. PMA-induced phenotypic changes in K562 cells: MAPK-dependent and -independent events [J]. Leukemia, 1998, 12(12): 1951-1961.

shRNA	Target sequence (5′→3′)
PG-shCT63-1	GCTTTGCATATCCATGTTCTA
PG-shCT63-2	GCCATTGATAGATACCTCAAA
PG-shCT63-3	CCAAACACATTACGCCACGTT
PG-shCT63-4	GCTACAGTTATTAGATGGCT
PG-shCT63-5	GCCTGAGGTGAATCCATTGTA
PG-shCtrl	CCTAAGGTTAAGTCGCCCTCG

shRNA	Target sequence (5′→3′)
PG-shCT63-1	GCTTTGCATATCCATGTTCTA
PG-shCT63-2	GCCATTGATAGATACCTCAAA
PG-shCT63-3	CCAAACACATTACGCCACGTT
PG-shCT63-4	GCTACAGTTATTAGATGGCT
PG-shCT63-5	GCCTGAGGTGAATCCATTGTA
PG-shCtrl	CCTAAGGTTAAGTCGCCCTCG

Gene	Forward primer (5′→3′)	Reverse primer (5′→3′)
CT63	CATCGTGGGGAATGAGAGGG	GATTGCAGAGGGGCACAGAT
mtDNA	CGAAAGGACAAGAGAAATAAGG	CTGTAAAGTTTTAAGTTTTATGCG
Nuclear	CAACTTCATCCACGTTCACC	GAAGAGCCAAGGACAGGTAC
HSP60	GTGTAGACCTTTTAGCCGATGC	GTGCCAGTACAGTAGCAGTGG

Gene	Forward primer (5′→3′)	Reverse primer (5′→3′)
CT63	CATCGTGGGGAATGAGAGGG	GATTGCAGAGGGGCACAGAT
mtDNA	CGAAAGGACAAGAGAAATAAGG	CTGTAAAGTTTTAAGTTTTATGCG
Nuclear	CAACTTCATCCACGTTCACC	GAAGAGCCAAGGACAGGTAC
HSP60	GTGTAGACCTTTTAGCCGATGC	GTGCCAGTACAGTAGCAGTGG

[1]	SHI Lingling, CHENG Yanyong, ZHANG Lei. Effects of sevoflurane exposure on proliferation and differentiation of primary oligodendrocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1115-1123.
[2]	TAN Lu, SHEN Shaoming, HE Ping. Function and mechanism study of hypoxia-induced long non-coding RNA 68 in hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(6): 702-712.
[3]	CAI Renjie, XU Ming. KHSRP regulates the responsiveness of prostate cancer cells to androgens through ANK3 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 417-426.
[4]	AN Junyi, CHEN Biying, CHEN Xunrui, YIN Shanshan, BIAN Zhouliang, LIU Feng. SFXN3 expression in head and neck squamous cell carcinoma and its effect on cell proliferation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 427-434.
[5]	LI Huxiao, LI Xiaotian, ZHAO Xuri, ZHANG Huanyu, ZHOU Wei, SONG Zhongchen. Effects of gingipain extract on the biological characteristics of oral squamous cell carcinoma cell HN6 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 161-168.
[6]	LUO Lange, ZHENG Chao, LEI Ming. Promotive effect of cancer-testis antigen CT57 on proliferation, invasion, migration and epithelial-mesenchymal transition of liver cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1335-1346.
[7]	Aishanjiang Kedeerya, FU Yi, LAI Donglin, WU Hailong, GONG Wei. An integrated prognostic model of nuclear-encoded mitochondrial gene signature and clinical information for hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(1): 1-12.
[8]	JIN Fangquan, FAN Chenghu, TANG Xiaodong, CHEN Yantong, QI Bingxian. Research progress in the relationship between mitochondrial dysfunction and osteoporosis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 761-767.
[9]	CHEN Jin, FU Yao. Research progress in autologous regeneration of human corneal endothelial cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 775-780.
[10]	HONG Hanxin, WANG Longhao, LIU Huihui, PENG Hu, WU Hao, YANG Tao. Construction of translocase of inner mitochondrial membrane 8A gene knockout mice and study of its inner ear function [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 261-268.
[11]	LIU Tiexin, LIN Junqing, ZHENG Xianyou. Research progress of subcellular structure-targeted therapy in spinal cord injury [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(2): 230-236.
[12]	SHA Xudong, WANG Chenfei, LU Jia, YU Zhihua. Regulation of high-fat diet-induced microglial metabolism by transient receptor potential vanilloid type 1 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1493-1506.
[13]	YANG Wanli, SONG Juan, LI Bing, LAO Yimin. Deciphering the suppressive effects of CBX8 on prostate cancer cell invasion [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1507-1519.
[14]	XIE Lin, CHENG Ye, ZHENG Qimin, ZHANG Xi, FU Lili, CHEN Min, WANG Yi, MEI Changlin, XIE Jingyuan, GU Xiangchen. Preventive effect of icariin on transition from acute kidney injury to chronic kidney disease in mouse model [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 8-19.
[15]	FENG Baoyi, DONG Tingting, ZHENG Xiaofei, TAO Yong, WU Hao. Comparison of mitochondria and NAD⁺ level in the murine cochleae of C57BL/6J mice at different ages [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 980-986.