An integrated prognostic model of nuclear-encoded mitochondrial gene signature and clinical information for hepatocellular carcinoma

doi:10.3969/j.issn.1674-8115.2024.01.001

Abstract

Abstract:

Objective ·To establish a prognostic model for the overall survival (OS) of hepatocellular carcinoma (HCC) based on mitochondrial genes and clinical information. Methods ·The gene expression and the clinical data of 369 HCC patients and 50 controls with normal liver were downloaded from The Cancer Genome Atlas (TCGA) database. The nuclear-encoded mitochondrial genes (NEMGs) were obtained from the MitoCarta3.0 database. The "DESeq2" R package and univariate Cox analysis were used to select NEMGs [ubiquinol cytochrome C reductase hinge protein (UQCRH),ATP citrate lyase (ACLY),phosphoenolpyruvate carboxykinase 2 (PCK2), Bcl-2 homologous antagonist/killer1 (BAK1), Bcl-2-associated X protein (BAX) andBcl-2/adenovirus E1B interacting protein 3-like (BNIP3L)] in HCC that were associated with OS of HCC and participated in dysregulation of oxidative phosphorylation, tricarboxylic acid cycle and cell apoptosis. Multivariate Cox analysis was applied to select independent risk factors for OS of HCC. A comprehensive prognostic model and a prognostic nomogram with 6-NEMG risk characteristics and TNM staging were established. By using the median of prognostic scores as a cut-off, HCC patients were classified into low-risk and high-risk group. Kaplan-Meier survival curve analysis was conducted and log-rank test was performed to evaluate the survival rates between the low-risk and high-risk group. The area under the curve (AUC) values of receiver operating characteristic (ROC) curve were calculated via using the "timeROC" package. The prognostic model for HCC was validated by using the GEO HCC cohort (GSE14520) for 1, 3 and 5 years. Finally, the relative expression level of 6-NEMG was validated in 34 clinical samples of HCC from Xinhua Hospital, Shanghai Jiao Tong University School of Medicine by using real-time quantitative polymerase chain reaction (qPCR) method. Results ·Compared to 6-NEMG risk signature only (AUCs for 1, 3 and 5 years were 0.77, 0.66 and 0.65, respectively) or TNM stage only (AUCs for 1, 3 and 5 years were 0.66, 0.67 and 0.63, respectively), ROC curve analysis showed that this integrated prognostic model displayed better predictive performance for 1-year (AUC, 0.78), 3-year (AUC, 0.73) and 5-year (AUC, 0.69) OS of HCC. The Kaplan-Meier survival curve analysis showed that the OS of HCC patients in the high-risk group was significantly worse than that in the low-risk group (P=0.001). In addition, predictive performance of the prognostic model (AUC for 1, 3 and 5 years is 0.67, 0.66 and 0.74, respectively) and prognostic differences between the high-risk and low-risk group (P=0.001) were further validated in GEO (GSE14520) external cohort, and these results were consistent with the TCGA data. In addition to BNIP3L, dysregulation of five other NEMGs in the clinical HCC cohort was validated. The correlation analysis in GSE14520 and HCC clinical cohort showed a positive correlation between prognosis score and the size and number of tumors. Conclusion ·A new prognostic model that combines 6-NEMG risk characteristics with TNM staging for predicting OS in HCC patients was constructed and validated. This model may help improve the prognosis prediction of HCC patients.

Key words: nuclear encoded mitochondrial gene, hepatocellular carcinoma, TCGA, GEO, overall survival

CLC Number:

R657.3

Aishanjiang Kedeerya, FU Yi, LAI Donglin, WU Hailong, GONG Wei. An integrated prognostic model of nuclear-encoded mitochondrial gene signature and clinical information for hepatocellular carcinoma[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(1): 1-12.

Figures/Tables 7

TrendMD

References 42

1	MILLER K D, FIDLER-BENAOUDIA M, KEEGAN T H, et al. Cancer statistics for adolescents and young adults, 2020[J]. CA Cancer J Clin, 2020, 70(6): 443-459.
2	SIEGEL R L, MILLER K D, FUCHS H E, et al. Cancer statistics, 2021[J]. CA A Cancer J Clinicians, 2021, 71(1): 7-33.
3	SANGRO B, SAROBE P, HERVÁS-STUBBS S, et al. Advances in immunotherapy for hepatocellular carcinoma[J]. Nat Rev Gastroenterol Hepatol, 2021, 18(8): 525-543.
4	RIMASSA L, PERSONENI N, CZAUDERNA C, et al. Systemic treatment of HCC in special populations[J]. J Hepatol, 2021, 74(4): 931-943.
5	BERTUCCIO P, TURATI F, CARIOLI G, et al. Global trends and predictions in hepatocellular carcinoma mortality[J]. J Hepatol, 2017, 67(2): 302-309.
6	YANG J D, HAINAUT P, GORES G J, et al. A global view of hepatocellular carcinoma: trends, risk, prevention and management[J]. Nat Rev Gastroenterol Hepatol, 2019, 16(10): 589-604.
7	ZHU J Y, TANG B F, LI J, et al. Identification and validation of the angiogenic genes for constructing diagnostic, prognostic, and recurrence models for hepatocellular carcinoma[J]. Aging, 2020, 12(9): 7848-7873.
8	DING Z B, ERICKSEN R E, LEE Q Y, et al. Reprogramming of mitochondrial proline metabolism promotes liver tumorigenesis[J]. Amino Acids, 2021, 53(12): 1807-1815.
9	MARQUEZ J, FLORES J, KIM A H, et al. Rescue of TCA cycle dysfunction for cancer therapy[J]. J Clin Med, 2019, 8(12): 2161.
10	SONG B S, MOON J S, TIAN J W, et al. Mitoribosomal defects aggravate liver cancer via aberrant glycolytic flux and T cell exhaustion[J]. J Immunother Cancer, 2022, 10(5): e004337.
11	LI M, WANG L, WANG Y J, et al. Mitochondrial fusion via OPA1 and MFN1 supports liver tumor cell metabolism and growth[J]. Cells, 2020, 9(1): 121.
12	LI X J, LI Y M, XU A J, et al. Apoptosis-induced translocation of centromere protein F in its corresponding autoantibody production in hepatocellular carcinoma[J]. Oncoimmunology, 2021, 10(1): 1992104.
13	CAI Y L, LIN Y X, XIONG X Z, et al. Knockdown expression of MECR, a novel gene of mitochondrial FAS Ⅱ inhibits growth and colony-formation, promotes apoptosis of hepatocelluar carcinoma cells[J]. Biosci Trends, 2019, 13(3): 234-244.
14	WALLACE D C. Mitochondria and cancer[J]. Nat Rev Cancer, 2012, 12(10): 685-698.
15	SANCHO P, BARNEDA D, HEESCHEN C. Hallmarks of cancer stem cell metabolism[J]. Br J Cancer, 2016, 114(12): 1305-1312.
16	KUNTZ E M, BAQUERO P, MICHIE A M, et al. Targeting mitochondrial oxidative phosphorylation eradicates therapy-resistant chronic myeloid leukemia stem cells[J]. Nat Med, 2017, 23(10): 1234-1240.
17	VAZQUEZ F, LIM J H, CHIM H, et al. PGC1α expression defines a subset of human melanoma tumors with increased mitochondrial capacity and resistance to oxidative stress[J]. Cancer Cell, 2013, 23(3): 287-301.
18	FARGE T, SALAND E, DE TONI F, et al. Chemotherapy-resistant human acute myeloid leukemia cells are not enriched for leukemic stem cells but require oxidative metabolism[J]. Cancer Discov, 2017, 7(7): 716-735.
19	ABBAS S, LUGTHART S, KAVELAARS F G, et al. Acquired mutations in the genes encoding IDH1 and IDH2 both are recurrent aberrations in acute myeloid leukemia: prevalence and prognostic value[J]. Blood, 2010, 116(12): 2122-2126.
20	PASINI B, MCWHINNEY S R, BEI T, et al. Clinical and molecular genetics of patients with the Carney-Stratakis syndrome and germline mutations of the genes coding for the succinate dehydrogenase subunits SDHB, SDHC, and SDHD[J]. Eur J Hum Genet, 2008, 16(1): 79-88.
21	LEHTONEN H J, BLANCO I, PIULATS J M, et al. Conventional renal cancer in a patient with fumarate hydratase mutation[J]. Hum Pathol, 2007, 38(5): 793-796.
22	FU J, LIU G X, ZHANG X, et al. TRPM8 promotes hepatocellular carcinoma progression by inducing SNORA55 mediated nuclear-mitochondrial communication[J]. Cancer Gene Ther, 2023, 30(5): 738-751.
23	HUANG Q C, WU D, ZHAO J, et al. TFAM loss induces nuclear actin assembly upon mDia2 malonylation to promote liver cancer metastasis[J]. EMBO J, 2022, 41(11): e110324.
24	CHELLA KRISHNAN K, KURT Z, BARRERE-CAIN R, et al. Integration of multi-omics data from mouse diversity panel highlights mitochondrial dysfunction in non-alcoholic fatty liver disease[J]. Cell Syst, 2018, 6(1): 103-115.e7.
25	WALLACE D C. Mitochondria and cancer[J]. Nat Rev Cancer, 2012, 12(10): 685-698.
26	LUO Y D, MA J J, LU W Q. The significance of mitochondrial dysfunction in cancer[J]. Int J Mol Sci, 2020, 21(16): 5598.
27	GAO F, LIU Q C, LI G P, et al. Identification of ubiquinol cytochrome c reductase hinge (UQCRH) as a potential diagnostic biomarker for lung adenocarcinoma[J]. Open Biol, 2016, 6(6): 150256.
28	PARK E R, KIM S B, LEE J S, et al. The mitochondrial hinge protein, UQCRH, is a novel prognostic factor for hepatocellular carcinoma[J]. Cancer Med, 2017, 6(4): 749-760.
29	SUN H, WANG F C, HUANG Y Q, et al. Targeted inhibition of ACLY expression to reverse the resistance of sorafenib in hepatocellular carcinoma[J]. J Cancer, 2022, 13(3): 951-964.
30	GRANCHI C. ATP citrate lyase (ACLY) inhibitors: an anti-cancer strategy at the crossroads of glucose and lipid metabolism[J]. Eur J Med Chem, 2018, 157: 1276-1291.
31	WEI J, LEIT S, KUAI J, et al. An allosteric mechanism for potent inhibition of human ATP-citrate lyase[J]. Nature, 2019, 568(7753): 566-570.
32	ICARD P, WU Z R, FOURNEL L, et al. ATP citrate lyase: a central metabolic enzyme in cancer[J]. Cancer Lett, 2020, 471: 125-134.
33	HAN Q, CHEN C A, YANG W, et al. ATP-citrate lyase regulates stemness and metastasis in hepatocellular carcinoma via the Wnt/β-catenin signaling pathway[J]. Hepatobiliary Pancreat Dis Int, 2021, 20(3): 251-261.
34	LEITHNER K, HRZENJAK A, TRÖTZMÜLLER M, et al. PCK2 activation mediates an adaptive response to glucose depletion in lung cancer[J]. Oncogene, 2015, 34(8): 1044-1050.
35	HYROŠŠOVÁ P, ARAGÓ M, MORENO-FELICI J, et al. PEPCK-M recoups tumor cell anabolic potential in a PKC-ζ-dependent manner[J]. Cancer Metab, 2021, 9(1): 1.
36	BLUEMEL G, PLANQUE M, MADREITER-SOKOLOWSKI C T, et al. PCK2 opposes mitochondrial respiration and maintains the redox balance in starved lung cancer cells[J]. Free Radic Biol Med, 2021, 176: 34-45.
37	LIU M X, JIN L, SUN S J, et al. Metabolic reprogramming by PCK1 promotes TCA cataplerosis, oxidative stress and apoptosis in liver cancer cells and suppresses hepatocellular carcinoma[J]. Oncogene, 2018, 37(12): 1637-1653.
38	COSENTINO K, HERTLEIN V, JENNER A, et al. The interplay between BAX and BAK tunes apoptotic pore growth to control mitochondrial-DNA-mediated inflammation[J]. Mol Cell, 2022, 82(5): 933-949.e9.
39	LUO X, O'NEILL K L, HUANG K. The third model of Bax/Bak activation: a Bcl-2 family feud finally resolved?[J]. F1000Research, 2020, 9: 935.
40	HAO B B, LI X J, JIA X L, et al. The novel cereblon modulator CC-885 inhibits mitophagy via selective degradation of BNIP3L[J]. Acta Pharmacol Sin, 2020, 41(9): 1246-1254.
41	LI Y, ZHENG W Q, LU Y Y, et al. BNIP3L/NIX-mediated mitophagy: molecular mechanisms and implications for human disease[J]. Cell Death Dis, 2021, 13(1): 14.
42	CHEN Y Y, WANG W H, CHE L, et al. BNIP3L-dependent mitophagy promotes HBx-induced cancer stemness of hepatocellular carcinoma cells via glycolysis metabolism reprogramming[J]. Cancers, 2020, 12(3): 655.

Primer	Forward sequence (5′→3′)	Reverse sequence (5′→3′)
UQCRH	GCTCTGTGATGAGCGTGTATCC	GTTGTTAAAGAGTTTGTGGGCCAC
ACLY	GCTCTGCCTATGACAGCACCAT	GTCCGATGATGGTCACTCCCTT
PCK2	TAGTGCCTGTGGCAAGACCAAC	GAAGCCGTTCTCAGGGTTGATG
BAK1	TTACCGCCATCAGCAGGAACAG	GGAACTCTGAGTCATAGCGTCG
BAX	TCAGGATGCGTCCACCAAGAAG	TGTGTCCACGGCGGCAATCATC
BNIP3L	TGTGGAAATGCACACCAGCAGG	CTACTGGACCAGTCTGATACCC
18S	GGAGAGGGAGCCTGAGAAACG	TTACAGGGCCTCGAAAGAGTCC

Primer	Forward sequence (5′→3′)	Reverse sequence (5′→3′)
UQCRH	GCTCTGTGATGAGCGTGTATCC	GTTGTTAAAGAGTTTGTGGGCCAC
ACLY	GCTCTGCCTATGACAGCACCAT	GTCCGATGATGGTCACTCCCTT
PCK2	TAGTGCCTGTGGCAAGACCAAC	GAAGCCGTTCTCAGGGTTGATG
BAK1	TTACCGCCATCAGCAGGAACAG	GGAACTCTGAGTCATAGCGTCG
BAX	TCAGGATGCGTCCACCAAGAAG	TGTGTCCACGGCGGCAATCATC
BNIP3L	TGTGGAAATGCACACCAGCAGG	CTACTGGACCAGTCTGATACCC
18S	GGAGAGGGAGCCTGAGAAACG	TTACAGGGCCTCGAAAGAGTCC

Feature	TCGA (n=339)			GEO (n=219)
Feature	High-risk group	Low-risk group	P value	High-risk group	Low-risk group	P value
Age/n(%)			0.681			0.969
≤50 years	36 (21.30)	39 (22.94)		53 (11.93)	58 (52.73)
>50 years	133 (78.73)	131 (77.06)		56 (88.07)	52 (47.27)
Gender/n(%)			0.254			0.156
Male	107 (63.31)	124 (72.94)		96 (88.07)	93 (84.55)
Female	62 (36.69)	46 (27.06)		13 (11.93)	17 (15.45)
Stage/n(%)			0.000			0.000
Ⅰ+Ⅱ	89 (52.66)	165 (97.06)		65 (59.63)	105 (95.45)
Ⅲ+Ⅳ	80 (47.34)	5 (2.94)		44 (40.37)	5 (4.55)
AFP/n(%)			0.031			0.045
≤20 ng·mL^-1 (TCGA) or ≤300 ng·mL^-1 (GEO)	118 (69.82)	111 (65.29)		57 (52.29)	61 (55.45)
>20 ng·mL^-1 (TCGA) or >300 ng·mL^-1 (GEO)	51 (30.18)	59 (34.71)		52 (47.71)	49 (44.55)
Event/n(%)
Survival	92 (54.44)	131 (77.06)		57 (52.29)	78 (70.91)
Death	77 (45.56)	39 (22.94)		52 (47.71)	32 (29.09)

Feature	TCGA (n=339)			GEO (n=219)
Feature	High-risk group	Low-risk group	P value	High-risk group	Low-risk group	P value
Age/n(%)			0.681			0.969
≤50 years	36 (21.30)	39 (22.94)		53 (11.93)	58 (52.73)
>50 years	133 (78.73)	131 (77.06)		56 (88.07)	52 (47.27)
Gender/n(%)			0.254			0.156
Male	107 (63.31)	124 (72.94)		96 (88.07)	93 (84.55)
Female	62 (36.69)	46 (27.06)		13 (11.93)	17 (15.45)
Stage/n(%)			0.000			0.000
Ⅰ+Ⅱ	89 (52.66)	165 (97.06)		65 (59.63)	105 (95.45)
Ⅲ+Ⅳ	80 (47.34)	5 (2.94)		44 (40.37)	5 (4.55)
AFP/n(%)			0.031			0.045
≤20 ng·mL^-1 (TCGA) or ≤300 ng·mL^-1 (GEO)	118 (69.82)	111 (65.29)		57 (52.29)	61 (55.45)
>20 ng·mL^-1 (TCGA) or >300 ng·mL^-1 (GEO)	51 (30.18)	59 (34.71)		52 (47.71)	49 (44.55)
Event/n(%)
Survival	92 (54.44)	131 (77.06)		57 (52.29)	78 (70.91)
Death	77 (45.56)	39 (22.94)		52 (47.71)	32 (29.09)

Feature	Total/n(%)
Age
≤50 year	8 (23.53)
>50 year	26 (76.47)
Gender
Male	24 (70.59)
Female	10 (29.41)
TNM stage
Ⅰ	15 (44.12)
Ⅱ	5 (14.71)
Ⅲ	11 (32.35)
Ⅳ	3 (8.82)
AFP
≤20 ng·mL^-1	21 (61.76)
>20 ng·mL^-1	13 (38.24)
Size
≤5 cm	20 (58.82)
>5 cm	14 (41.18)
Tumor number
=1	22 (64.71)
>1	12 (35.29)
HBsAg
-	7 (20.59)
+	27 (79.41)
GPT
≤40 U·L^-1	25 (73.53)
>40 U·L^-1	9 (26.47)
Cirrhosis
-	16 (40.06)
+	18 (59.94)