
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2024, Vol. 44 ›› Issue (1): 1-12.doi: 10.3969/j.issn.1674-8115.2024.01.001
• Basic research • Next Articles
Aishanjiang Kedeerya1,2(
), FU Yi2, LAI Donglin2,3, WU Hailong2,4(
), GONG Wei1,5(
)
Received:2023-09-18
Accepted:2023-12-06
Online:2024-01-28
Published:2024-01-28
Contact:
WU Hailong,GONG Wei
E-mail:kadirya95@163.com;wuhl@sumhs.edu.cn;gongwei@xinhuamed.com.cn
Supported by:CLC Number:
Aishanjiang Kedeerya, FU Yi, LAI Donglin, WU Hailong, GONG Wei. An integrated prognostic model of nuclear-encoded mitochondrial gene signature and clinical information for hepatocellular carcinoma[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024,(1): 1-12.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2024.01.001
| Primer | Forward sequence (5′→3′) | Reverse sequence (5′→3′) |
|---|---|---|
| UQCRH | GCTCTGTGATGAGCGTGTATCC | GTTGTTAAAGAGTTTGTGGGCCAC |
| ACLY | GCTCTGCCTATGACAGCACCAT | GTCCGATGATGGTCACTCCCTT |
| PCK2 | TAGTGCCTGTGGCAAGACCAAC | GAAGCCGTTCTCAGGGTTGATG |
| BAK1 | TTACCGCCATCAGCAGGAACAG | GGAACTCTGAGTCATAGCGTCG |
| BAX | TCAGGATGCGTCCACCAAGAAG | TGTGTCCACGGCGGCAATCATC |
| BNIP3L | TGTGGAAATGCACACCAGCAGG | CTACTGGACCAGTCTGATACCC |
| 18S | GGAGAGGGAGCCTGAGAAACG | TTACAGGGCCTCGAAAGAGTCC |
Tab 1 Primer sequences for qPCR
| Primer | Forward sequence (5′→3′) | Reverse sequence (5′→3′) |
|---|---|---|
| UQCRH | GCTCTGTGATGAGCGTGTATCC | GTTGTTAAAGAGTTTGTGGGCCAC |
| ACLY | GCTCTGCCTATGACAGCACCAT | GTCCGATGATGGTCACTCCCTT |
| PCK2 | TAGTGCCTGTGGCAAGACCAAC | GAAGCCGTTCTCAGGGTTGATG |
| BAK1 | TTACCGCCATCAGCAGGAACAG | GGAACTCTGAGTCATAGCGTCG |
| BAX | TCAGGATGCGTCCACCAAGAAG | TGTGTCCACGGCGGCAATCATC |
| BNIP3L | TGTGGAAATGCACACCAGCAGG | CTACTGGACCAGTCTGATACCC |
| 18S | GGAGAGGGAGCCTGAGAAACG | TTACAGGGCCTCGAAAGAGTCC |
| Feature | TCGA (n=339) | GEO (n=219) | ||||
|---|---|---|---|---|---|---|
| High-risk group | Low-risk group | P value | High-risk group | Low-risk group | P value | |
| Age/n(%) | 0.681 | 0.969 | ||||
| ≤50 years | 36 (21.30) | 39 (22.94) | 53 (11.93) | 58 (52.73) | ||
| >50 years | 133 (78.73) | 131 (77.06) | 56 (88.07) | 52 (47.27) | ||
| Gender/n(%) | 0.254 | 0.156 | ||||
| Male | 107 (63.31) | 124 (72.94) | 96 (88.07) | 93 (84.55) | ||
| Female | 62 (36.69) | 46 (27.06) | 13 (11.93) | 17 (15.45) | ||
| Stage/n(%) | 0.000 | 0.000 | ||||
| Ⅰ+Ⅱ | 89 (52.66) | 165 (97.06) | 65 (59.63) | 105 (95.45) | ||
| Ⅲ+Ⅳ | 80 (47.34) | 5 (2.94) | 44 (40.37) | 5 (4.55) | ||
| AFP/n(%) | 0.031 | 0.045 | ||||
≤20 ng·mL-1 (TCGA) or ≤300 ng·mL-1 (GEO) | 118 (69.82) | 111 (65.29) | 57 (52.29) | 61 (55.45) | ||
>20 ng·mL-1 (TCGA) or >300 ng·mL-1 (GEO) | 51 (30.18) | 59 (34.71) | 52 (47.71) | 49 (44.55) | ||
| Event/n(%) | ||||||
| Survival | 92 (54.44) | 131 (77.06) | 57 (52.29) | 78 (70.91) | ||
| Death | 77 (45.56) | 39 (22.94) | 52 (47.71) | 32 (29.09) | ||
Tab 2 Baseline characteristics of the patients in different risk groups
| Feature | TCGA (n=339) | GEO (n=219) | ||||
|---|---|---|---|---|---|---|
| High-risk group | Low-risk group | P value | High-risk group | Low-risk group | P value | |
| Age/n(%) | 0.681 | 0.969 | ||||
| ≤50 years | 36 (21.30) | 39 (22.94) | 53 (11.93) | 58 (52.73) | ||
| >50 years | 133 (78.73) | 131 (77.06) | 56 (88.07) | 52 (47.27) | ||
| Gender/n(%) | 0.254 | 0.156 | ||||
| Male | 107 (63.31) | 124 (72.94) | 96 (88.07) | 93 (84.55) | ||
| Female | 62 (36.69) | 46 (27.06) | 13 (11.93) | 17 (15.45) | ||
| Stage/n(%) | 0.000 | 0.000 | ||||
| Ⅰ+Ⅱ | 89 (52.66) | 165 (97.06) | 65 (59.63) | 105 (95.45) | ||
| Ⅲ+Ⅳ | 80 (47.34) | 5 (2.94) | 44 (40.37) | 5 (4.55) | ||
| AFP/n(%) | 0.031 | 0.045 | ||||
≤20 ng·mL-1 (TCGA) or ≤300 ng·mL-1 (GEO) | 118 (69.82) | 111 (65.29) | 57 (52.29) | 61 (55.45) | ||
>20 ng·mL-1 (TCGA) or >300 ng·mL-1 (GEO) | 51 (30.18) | 59 (34.71) | 52 (47.71) | 49 (44.55) | ||
| Event/n(%) | ||||||
| Survival | 92 (54.44) | 131 (77.06) | 57 (52.29) | 78 (70.91) | ||
| Death | 77 (45.56) | 39 (22.94) | 52 (47.71) | 32 (29.09) | ||
| Feature | Total/n(%) |
|---|---|
| Age | |
| ≤50 year | 8 (23.53) |
| >50 year | 26 (76.47) |
| Gender | |
| Male | 24 (70.59) |
| Female | 10 (29.41) |
| TNM stage | |
| Ⅰ | 15 (44.12) |
| Ⅱ | 5 (14.71) |
| Ⅲ | 11 (32.35) |
| Ⅳ | 3 (8.82) |
| AFP | |
| ≤20 ng·mL-1 | 21 (61.76) |
| >20 ng·mL-1 | 13 (38.24) |
| Size | |
| ≤5 cm | 20 (58.82) |
| >5 cm | 14 (41.18) |
| Tumor number | |
| =1 | 22 (64.71) |
| >1 | 12 (35.29) |
| HBsAg | |
| - | 7 (20.59) |
| + | 27 (79.41) |
| GPT | |
| ≤40 U·L-1 | 25 (73.53) |
| >40 U·L-1 | 9 (26.47) |
| Cirrhosis | |
| - | 16 (40.06) |
| + | 18 (59.94) |
Tab 3 Clinicopathological features of HCC patients in the clinical cohort
| Feature | Total/n(%) |
|---|---|
| Age | |
| ≤50 year | 8 (23.53) |
| >50 year | 26 (76.47) |
| Gender | |
| Male | 24 (70.59) |
| Female | 10 (29.41) |
| TNM stage | |
| Ⅰ | 15 (44.12) |
| Ⅱ | 5 (14.71) |
| Ⅲ | 11 (32.35) |
| Ⅳ | 3 (8.82) |
| AFP | |
| ≤20 ng·mL-1 | 21 (61.76) |
| >20 ng·mL-1 | 13 (38.24) |
| Size | |
| ≤5 cm | 20 (58.82) |
| >5 cm | 14 (41.18) |
| Tumor number | |
| =1 | 22 (64.71) |
| >1 | 12 (35.29) |
| HBsAg | |
| - | 7 (20.59) |
| + | 27 (79.41) |
| GPT | |
| ≤40 U·L-1 | 25 (73.53) |
| >40 U·L-1 | 9 (26.47) |
| Cirrhosis | |
| - | 16 (40.06) |
| + | 18 (59.94) |
| 1 | MILLER K D, FIDLER-BENAOUDIA M, KEEGAN T H, et al. Cancer statistics for adolescents and young adults, 2020[J]. CA Cancer J Clin, 2020, 70(6): 443-459. |
| 2 | SIEGEL R L, MILLER K D, FUCHS H E, et al. Cancer statistics, 2021[J]. CA A Cancer J Clinicians, 2021, 71(1): 7-33. |
| 3 | SANGRO B, SAROBE P, HERVÁS-STUBBS S, et al. Advances in immunotherapy for hepatocellular carcinoma[J]. Nat Rev Gastroenterol Hepatol, 2021, 18(8): 525-543. |
| 4 | RIMASSA L, PERSONENI N, CZAUDERNA C, et al. Systemic treatment of HCC in special populations[J]. J Hepatol, 2021, 74(4): 931-943. |
| 5 | BERTUCCIO P, TURATI F, CARIOLI G, et al. Global trends and predictions in hepatocellular carcinoma mortality[J]. J Hepatol, 2017, 67(2): 302-309. |
| 6 | YANG J D, HAINAUT P, GORES G J, et al. A global view of hepatocellular carcinoma: trends, risk, prevention and management[J]. Nat Rev Gastroenterol Hepatol, 2019, 16(10): 589-604. |
| 7 | ZHU J Y, TANG B F, LI J, et al. Identification and validation of the angiogenic genes for constructing diagnostic, prognostic, and recurrence models for hepatocellular carcinoma[J]. Aging, 2020, 12(9): 7848-7873. |
| 8 | DING Z B, ERICKSEN R E, LEE Q Y, et al. Reprogramming of mitochondrial proline metabolism promotes liver tumorigenesis[J]. Amino Acids, 2021, 53(12): 1807-1815. |
| 9 | MARQUEZ J, FLORES J, KIM A H, et al. Rescue of TCA cycle dysfunction for cancer therapy[J]. J Clin Med, 2019, 8(12): 2161. |
| 10 | SONG B S, MOON J S, TIAN J W, et al. Mitoribosomal defects aggravate liver cancer via aberrant glycolytic flux and T cell exhaustion[J]. J Immunother Cancer, 2022, 10(5): e004337. |
| 11 | LI M, WANG L, WANG Y J, et al. Mitochondrial fusion via OPA1 and MFN1 supports liver tumor cell metabolism and growth[J]. Cells, 2020, 9(1): 121. |
| 12 | LI X J, LI Y M, XU A J, et al. Apoptosis-induced translocation of centromere protein F in its corresponding autoantibody production in hepatocellular carcinoma[J]. Oncoimmunology, 2021, 10(1): 1992104. |
| 13 | CAI Y L, LIN Y X, XIONG X Z, et al. Knockdown expression of MECR, a novel gene of mitochondrial FAS Ⅱ inhibits growth and colony-formation, promotes apoptosis of hepatocelluar carcinoma cells[J]. Biosci Trends, 2019, 13(3): 234-244. |
| 14 | WALLACE D C. Mitochondria and cancer[J]. Nat Rev Cancer, 2012, 12(10): 685-698. |
| 15 | SANCHO P, BARNEDA D, HEESCHEN C. Hallmarks of cancer stem cell metabolism[J]. Br J Cancer, 2016, 114(12): 1305-1312. |
| 16 | KUNTZ E M, BAQUERO P, MICHIE A M, et al. Targeting mitochondrial oxidative phosphorylation eradicates therapy-resistant chronic myeloid leukemia stem cells[J]. Nat Med, 2017, 23(10): 1234-1240. |
| 17 | VAZQUEZ F, LIM J H, CHIM H, et al. PGC1α expression defines a subset of human melanoma tumors with increased mitochondrial capacity and resistance to oxidative stress[J]. Cancer Cell, 2013, 23(3): 287-301. |
| 18 | FARGE T, SALAND E, DE TONI F, et al. Chemotherapy-resistant human acute myeloid leukemia cells are not enriched for leukemic stem cells but require oxidative metabolism[J]. Cancer Discov, 2017, 7(7): 716-735. |
| 19 | ABBAS S, LUGTHART S, KAVELAARS F G, et al. Acquired mutations in the genes encoding IDH1 and IDH2 both are recurrent aberrations in acute myeloid leukemia: prevalence and prognostic value[J]. Blood, 2010, 116(12): 2122-2126. |
| 20 | PASINI B, MCWHINNEY S R, BEI T, et al. Clinical and molecular genetics of patients with the Carney-Stratakis syndrome and germline mutations of the genes coding for the succinate dehydrogenase subunits SDHB, SDHC, and SDHD[J]. Eur J Hum Genet, 2008, 16(1): 79-88. |
| 21 | LEHTONEN H J, BLANCO I, PIULATS J M, et al. Conventional renal cancer in a patient with fumarate hydratase mutation[J]. Hum Pathol, 2007, 38(5): 793-796. |
| 22 | FU J, LIU G X, ZHANG X, et al. TRPM8 promotes hepatocellular carcinoma progression by inducing SNORA55 mediated nuclear-mitochondrial communication[J]. Cancer Gene Ther, 2023, 30(5): 738-751. |
| 23 | HUANG Q C, WU D, ZHAO J, et al. TFAM loss induces nuclear actin assembly upon mDia2 malonylation to promote liver cancer metastasis[J]. EMBO J, 2022, 41(11): e110324. |
| 24 | CHELLA KRISHNAN K, KURT Z, BARRERE-CAIN R, et al. Integration of multi-omics data from mouse diversity panel highlights mitochondrial dysfunction in non-alcoholic fatty liver disease[J]. Cell Syst, 2018, 6(1): 103-115.e7. |
| 25 | WALLACE D C. Mitochondria and cancer[J]. Nat Rev Cancer, 2012, 12(10): 685-698. |
| 26 | LUO Y D, MA J J, LU W Q. The significance of mitochondrial dysfunction in cancer[J]. Int J Mol Sci, 2020, 21(16): 5598. |
| 27 | GAO F, LIU Q C, LI G P, et al. Identification of ubiquinol cytochrome c reductase hinge (UQCRH) as a potential diagnostic biomarker for lung adenocarcinoma[J]. Open Biol, 2016, 6(6): 150256. |
| 28 | PARK E R, KIM S B, LEE J S, et al. The mitochondrial hinge protein, UQCRH, is a novel prognostic factor for hepatocellular carcinoma[J]. Cancer Med, 2017, 6(4): 749-760. |
| 29 | SUN H, WANG F C, HUANG Y Q, et al. Targeted inhibition of ACLY expression to reverse the resistance of sorafenib in hepatocellular carcinoma[J]. J Cancer, 2022, 13(3): 951-964. |
| 30 | GRANCHI C. ATP citrate lyase (ACLY) inhibitors: an anti-cancer strategy at the crossroads of glucose and lipid metabolism[J]. Eur J Med Chem, 2018, 157: 1276-1291. |
| 31 | WEI J, LEIT S, KUAI J, et al. An allosteric mechanism for potent inhibition of human ATP-citrate lyase[J]. Nature, 2019, 568(7753): 566-570. |
| 32 | ICARD P, WU Z R, FOURNEL L, et al. ATP citrate lyase: a central metabolic enzyme in cancer[J]. Cancer Lett, 2020, 471: 125-134. |
| 33 | HAN Q, CHEN C A, YANG W, et al. ATP-citrate lyase regulates stemness and metastasis in hepatocellular carcinoma via the Wnt/β-catenin signaling pathway[J]. Hepatobiliary Pancreat Dis Int, 2021, 20(3): 251-261. |
| 34 | LEITHNER K, HRZENJAK A, TRÖTZMÜLLER M, et al. PCK2 activation mediates an adaptive response to glucose depletion in lung cancer[J]. Oncogene, 2015, 34(8): 1044-1050. |
| 35 | HYROŠŠOVÁ P, ARAGÓ M, MORENO-FELICI J, et al. PEPCK-M recoups tumor cell anabolic potential in a PKC-ζ-dependent manner[J]. Cancer Metab, 2021, 9(1): 1. |
| 36 | BLUEMEL G, PLANQUE M, MADREITER-SOKOLOWSKI C T, et al. PCK2 opposes mitochondrial respiration and maintains the redox balance in starved lung cancer cells[J]. Free Radic Biol Med, 2021, 176: 34-45. |
| 37 | LIU M X, JIN L, SUN S J, et al. Metabolic reprogramming by PCK1 promotes TCA cataplerosis, oxidative stress and apoptosis in liver cancer cells and suppresses hepatocellular carcinoma[J]. Oncogene, 2018, 37(12): 1637-1653. |
| 38 | COSENTINO K, HERTLEIN V, JENNER A, et al. The interplay between BAX and BAK tunes apoptotic pore growth to control mitochondrial-DNA-mediated inflammation[J]. Mol Cell, 2022, 82(5): 933-949.e9. |
| 39 | LUO X, O'NEILL K L, HUANG K. The third model of Bax/Bak activation: a Bcl-2 family feud finally resolved?[J]. F1000Research, 2020, 9: 935. |
| 40 | HAO B B, LI X J, JIA X L, et al. The novel cereblon modulator CC-885 inhibits mitophagy via selective degradation of BNIP3L[J]. Acta Pharmacol Sin, 2020, 41(9): 1246-1254. |
| 41 | LI Y, ZHENG W Q, LU Y Y, et al. BNIP3L/NIX-mediated mitophagy: molecular mechanisms and implications for human disease[J]. Cell Death Dis, 2021, 13(1): 14. |
| 42 | CHEN Y Y, WANG W H, CHE L, et al. BNIP3L-dependent mitophagy promotes HBx-induced cancer stemness of hepatocellular carcinoma cells via glycolysis metabolism reprogramming[J]. Cancers, 2020, 12(3): 655. |
| [1] | Hao Fengjie, Wang Junqing, Lu Ye. Immune cell traits mediate the association between alcoholic liver disease and hepatocellular carcinoma: a Mendelian randomization and mediation analysis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(7): 961-971. |
| [2] | Gao Linna, Tang Yangyang, Liu Yifan, Xu Junming, Xing Tonghai. Prediction of postoperative prognosis in hepatocellular carcinoma patients undergoing liver transplantation based on preoperative CT imaging combined with clinical indicators [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(5): 642-650. |
| [3] | LI Qianyu, QIAN Yifei, LI Songling, ZHU Zijun, QIN Wenli, LIU Yanfeng, QIU Bijun. Function and mechanism of suppressor of zeste 12 in hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1138-1148. |
| [4] | ZHU Zijun, QIAN Yife, LI Qianyu, LI Songling, QIN Wenli, LIU Yanfeng. Anaphase-promoting complex subunit 10 promotes hepatocellular carcinoma progression through regulation of the PI3K-AKT-mTOR signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1171-1182. |
| [5] | LI Qianyu, GUO Wenyun, QIAN Yifei, LI Songling, ZHU Zijun, LIU Yanfeng. Study on the significance and mechanism of ASGR1 in hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(9): 1107-1114. |
| [6] | YU Li, SU Xiandu, ZHANG Min, LI Yahui, WANG Le. Construction and validation of prognostic risk model for hepatocellular carcinoma based on biological analysis of palmitoyl-associated enzyme long-chain non-coding RNA [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 747-754. |
| [7] | YANG Xiaoxuan, ZHU Shan, QIAN Cheng, CHU Xiaoying. Effect of intraoperative use of low-dose dexmedetomidine on the prognosis of patients undergoing breast cancer surgery [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(2): 194-200. |
| [8] | BENEDICK Jun Er Chin, SON Peng, ZHANG Yifan, WANG Junqing, GUO Simin. Research progress of the impact of nonalcoholic fatty liver disease on chronic hepatitis B infection [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1585-1590. |
| [9] | HAN Xiaxia, JIANG Yang, GU Shuangshuang, DAI Dai, SHEN Nan. Transcriptomic analysis of metabolic characteristics of the immune cells in systemic lupus erythematosus patients [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1197-1207. |
| [10] | LU Yu, WANG Hao, BA Qian. Role of gut microbiota in hepatocellular carcinoma: cancer occurrence, progresses and treatments [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 939-944. |
| [11] | HU Zhexuan, ZHANG Xin, WO Lulu, LI Jingchi, WANG Jiao, ZHOU Cixiang, ZHAO Qian. Study on the function of TRMT61A in liver cancer cell and its mechanism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 742-750. |
| [12] | JIN Bu, YUAN Ying, CHEN Wanyu, XU Hudong, HUANG Xiaolei, HE Jialu, YU Hong. Involvement of miRNA target genes in esophageal squamous cell carcinoma through ubiquitination based on GEO database [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(4): 464-471. |
| [13] | Yihuan WANG, Ruokun LI, Huanhuan CHONG, Fuhua YAN. Research progress of Gd-EOB-DTPA-enhanced magnetic resonance imaging in the evaluation of biological behavior of hepatocellular carcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 130-134. |
| [14] | Bei-bei XUAN, Sai-nan GONG, Jia-li LIU, Quan QUAN, Yu MENG, Xiao-ling MU. Expression and clinical significance of DNA polymerase θ in endometrial cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(9): 1207-1214. |
| [15] | Yin LIU, Tao YANG, Yu-sai XIE, Yu-zhu WANG. Screening of key genes and pathways involved in lupus nephritis based on GEO database [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 749-755. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||