Construction of translocase of inner mitochondrial membrane 8A gene knockout mice and study of its inner ear function

doi:10.3969/j.issn.1674-8115.2023.03.001

Abstract

Abstract:

Objective ·To explore the hearing phenotype of Timm8a^-^/- mice and the function of translocase of inner mitochondrial membrane 8A(Timm8a)gene in inner ear by constructing Timm8a gene knockout mice. Methods ·Timm8a^-^/- mice were designed and constructed. PCR and Western blotting were used to verify whether the construction was successful. The body size and weight of Timm8a^-/- mice and wild type (WT) mice aged one-month were observed and compared. Immunofluorescence staining was used to observe the expression and distribution of TIMM8A protein in the cochlea of WT mice. Auditory brainstem response (ABR) was used to compare the hearing threshold of Timm8a^-^/- mice and WT mice. Toluidine blue staining was performed to observe the morphology of organ of Corti (OC), spiral ganglion neuron (SGN) and stria vascularis (SV) in the inner ear of the two kinds of mice. Transmission electron microscope was used to observe the ultrastructure of mitochondria in inner ear hair cells (HCs), SGN cells and SV cells of the two kinds of mice, and the proportion of abnormal mitochondria was counted. Results ·The results of PCR showed that Timm8a gene had been successfully knocked out, and the results of Western blotting showed that there was no TIMM8A proteins in the cochlea, brain, heart and skeletal muscle tissues. The both results indicated that Timm8a^-^/- mice were successfully constructed. The results of immunofluorescence staining showed that TIMM8A was abundantly expressed in the cochlea of WT mice, and was highly expressed in the OC, SGN and SV. Compared with WT mice, Timm8a^-^/- miceaged one-month developed slower, had lighter body weight and significantly higher hearing threshold (all P<0.05), their amplitude of Ⅰ wave of ABR was decreased and the latency was prolonged. The results of toluidine blue staining showed that compared with WT mice, there was no significant change in the shape and number of SGN cells in the inner ear, but the thickness of SV in the middle turn and basal turn of the cochlea was reduced (both P<0.05). The results of transmission electron microscope showed that compared with WT mice, the structure of mitochondria in inner ear HCs, SGN cells and SV cells of Timm8a^-^/- mice was abnormal, and the proportion of abnormal mitochondria was significantly increased (all P<0.05). Conclusion ·Timm8a^-^/- mice are successfully constructed in this study, and the elevated hearing threshold of Timm8a^-^/- mice may be related to the abnormal ultrastructure of mitochondria in inner ear.

Key words: translocase of inner mitochondrial membrane 8A (TIMM8A), Mohr-Tranebjaerg syndrome (MTS), auditory neuropathy spectrum disorder (ANSD), mitochondria

CLC Number:

R764.43

HONG Hanxin, WANG Longhao, LIU Huihui, PENG Hu, WU Hao, YANG Tao. Construction of translocase of inner mitochondrial membrane 8A gene knockout mice and study of its inner ear function[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 261-268.

Figures/Tables 6

Fig 1 Schematic diagram of the construction of the Timm8a-/- mice

Tab 1 Primer sequences for Timm8a-/- mouse genotyping

Primer	Forward sequence (5'→3')	Reverse sequence (5'→3')
Timm8a	TTGGGGCACCTAACTGAT	CAAAGCAAGGCAATGGAATA
ACTB-Cre 1	GCGGTCTGGCAGTAAAAACTATC	GTAGGTGGAAATTCTAGCATCATCC
ACTB-Cre 2	CTAGGCCACAGAATTGAAAGATCT	GTGAAACAGCATTGCTGTCACTT

Fig 2 Verification of Timm8a-/- mouse construction and observation of its body size with WT mice

Fig 3 Expression and localization of TIMM8A in cochlear tissue and comparison of the hearing phenotype between Timm8a-/- mice and WT mice

Fig 4 Pathological analysis of inner ear between Timm8a-/- mice and WT mice

Fig 5 Observation of mitochondrial ultrastructure and analysis of the proportion of abnormal structure in inner ear HCs, SGN cells and SV cells of Timm8a-/- mice and WT mice

TrendMD

References 18

1	KANG Y L, ANDERSON A J, JACKSON T D, et al. Function of hTim8a in complex Ⅳ assembly in neuronal cells provides insight into pathomechanism underlying Mohr-Tranebjærg syndrome[J]. Elife, 2019, 8: e48828.
2	SONG P P, GUAN Y Q, CHEN X, et al. Frameshift mutation of Timm8a1 gene in mouse leads to an abnormal mitochondrial structure in the brain, correlating with hearing and memory impairment[J]. J Med Genet, 2021, 58(9): 619-627.
3	HEINEMEYER T, STEMMET M, BARDIEN S, et al. Underappreciated roles of the translocase of the outer and inner mitochondrial membrane protein complexes in human disease[J]. DNA Cell Biol, 2019, 38(1): 23-40.
4	NEIGHBORS A, MOSS T, HOLLOWAY L, et al. Functional analysis of a novel mutation in the TIMM8A gene that causes deafness-dystonia-optic neuronopathy syndrome[J]. Mol Genet Genomic Med, 2020, 8(3): e1121.
5	HA A D, PARRATT K L, RENDTORFF N D, et al. The phenotypic spectrum of dystonia in Mohr-Tranebjaerg syndrome[J]. Mov Disord, 2012, 27(8): 1034-1040.
6	RUSSELL O M, GORMAN G S, LIGHTOWLERS R N, et al. Mitochondrial diseases: hope for the future[J]. Cell, 2020, 181(1): 168-188.
7	STENTON S L, PROKISCH H. Genetics of mitochondrial diseases: identifying mutations to help diagnosis[J]. EBioMedicine, 2020, 56: 102784.
8	GUSIC M, PROKISCH H. Genetic basis of mitochondrial diseases[J]. FEBS Lett, 2021, 595(8): 1132-1158.
9	MATRICARDI S, CANAFOGLIA L, ARDISSONE A, et al. Epileptic phenotypes in children with early-onset mitochondrial diseases[J]. Acta Neurol Scand, 2019, 140(3): 184-193.
10	GORMAN G S, CHINNERY P F, DIMAURO S, et al. Mitochondrial diseases[J]. Nat Rev Dis Primers, 2016, 2: 16080.
11	NG Y S, BINDOFF L A, GORMAN G S, et al. Mitochondrial disease in adults: recent advances and future promise[J]. Lancet Neurol, 2021, 20(7): 573-584.
12	ROESCH S, O'SULLIVAN A, ZIMMERMANN G, et al. Mitochondrial disease and hearing loss in children: a systematic review[J]. Laryngoscope, 2022, 132(12): 2459-2472.
13	LI J N, LIU C, MÜLLER U, et al. Autophagy proteins are essential for aminoglycoside-induced hearing loss[J]. Autophagy, 2022: 1-2.
14	GAO Y, KAMOGASHIRA T, FUJIMOTO C, et al. Effects of pyrroloquinoline quinone on noise-induced and age-related hearing loss in mice[J]. Sci Rep, 2022, 12(1): 15911.
15	KISHIMOTO-URATA M, URATA S, FUJIMOTO C, et al. Role of oxidative stress and antioxidants in acquired inner ear disorders[J]. Antioxidants (Basel), 2022, 11(8): 1469.
16	QUAN Y, XIN Y G, TIAN G E, et al. Mitochondrial ROS-modulated mtDNA: a potential target for cardiac aging[J]. Oxid Med Cell Longev, 2020, 2020: 9423593.
17	FETONI A R, PACIELLO F, ROLESI R, et al. Targeting dysregulation of redox homeostasis in noise-induced hearing loss: oxidative stress and ROS signaling[J]. Free Radic Biol Med, 2019, 135: 46-59.
18	PACIELLO F, PISANI A, ROLESI R, et al. Noise-induced cochlear damage involves PPAR down-regulation through the interplay between oxidative stress and inflammation[J]. Antioxidants (Basel), 2021, 10(8): 1188.

[1]	LIU Tiexin, LIN Junqing, ZHENG Xianyou. Research progress of subcellular structure-targeted therapy in spinal cord injury [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(2): 230-236.
[2]	XIE Lin, CHENG Ye, ZHENG Qimin, ZHANG Xi, FU Lili, CHEN Min, WANG Yi, MEI Changlin, XIE Jingyuan, GU Xiangchen. Preventive effect of icariin on transition from acute kidney injury to chronic kidney disease in mouse model [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 8-19.
[3]	FENG Baoyi, DONG Tingting, ZHENG Xiaofei, TAO Yong, WU Hao. Comparison of mitochondria and NAD⁺ level in the murine cochleae of C57BL/6J mice at different ages [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 980-986.
[4]	LIN Yijia, CHENG Lizhen, MIAO Ya. Research progress in the role and mechanism of abnormal mitophagy in Alzheimer's disease [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 387-392.
[5]	Lei XIONG, Qian YI, Ming-fang XU, Jian CHEN. Expression and prognosis analysis of MRPL12 in lung adenocarcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1033-1040.
[6]	Ya-zhong WEI, Xiao-mei XUE, Bin HE. Research progress in myocardial ischemia-reperfusion injury mediated by mitochondrial reactive oxygen species [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 826-829.
[7]	CHEN Wei, HAN Zheng, ZOU Yan-li, HUANG Sha-sha, TIAN Xia. Expressions and effects of serum miR-23a-3p and miR-27a-3p in mice with ulcerative colitis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(8): 1069-1074.
[8]	YANG Shuo-yao1, 2, QI Zi-yi3, XIANG Jun4. Research progress of mitochondrial Lon protease and its related diseases [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(5): 683-687.
[9]	JIAN Chao-hui, BAO Yu-qian. Research progress of autophagy in non-alcoholic fatty liver disease [J]. , 2018, 38(6): 690-.
[10]	XU Chen-qi1,MIN Lu-lin1,CHEN Xiao-huan3,LU Ren-hua1,ZHU Ming-li1,XIE Ke-wei1,QIAN Ying-ying1,GUO Xiang-jiang2,NI Zhao-hui1,AYIJIAKEN Kasimumali3#, GU Le-yi1# . Pyruvate dehydrogenase activity and pyruvate dehydrogenase kinase 4 expression in skeletal muscle of end-stage renal disease patients [J]. , 2018, 38(3): 305-.
[11]	HAN Ke-qi, RUAN Xin, HE Ming. Roles of SIRT2 in the tumorigenesis and development of hepatocellular carcinoma [J]. , 2018, 38(10): 1247-.
[12]	GUO Zhu-ying, XU Mang-hua, HE Wei, WANG Shi-ting. Effect of mitochondria permeability transition pore on H9c2 myocardial cell apoptosis induced by lipopolysaccharide#br# [J]. , 2017, 37(7): 942-.
[13]	FENG Jing, DENG Fei, ZHANG Ping, et al. Influence of Venenum Bufonis on proliferation and apoptosis in liver cancer cell HepG2 and relevant mechanisms [J]. , 2016, 36(3): 340-.
[14]	CHENG Pei-pei, FU Ying-mei, YU Shun-ying, et al. Changes of expressions of aerobic glycolytic enzymes in prefrontal cortex of patients with autism [J]. , 2015, 35(5): 653-.
[15]	SONG Li-li, WANG Wei-wei, SUN Yun, et al. Apoptosis of imatinib-sensitive and imatinib-resistant chronic myelocytic leukemia cells induced by isobavachalcone [J]. , 2014, 34(9): 1309-.