
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2024, Vol. 44 ›› Issue (11): 1335-1346.doi: 10.3969/j.issn.1674-8115.2024.11.001
• Innovative research team achievement column • Next Articles
LUO Lange(
), ZHENG Chao(
), LEI Ming(
)
Received:2024-02-21
Accepted:2024-04-23
Online:2024-11-28
Published:2024-11-28
Contact:
ZHENG Chao,LEI Ming
E-mail:l.lange@sjtu.edu.cn;zhengchao@shsmu.edu.cn;leim@shsmu.edu.cn
Supported by:CLC Number:
LUO Lange, ZHENG Chao, LEI Ming. Promotive effect of cancer-testis antigen CT57 on proliferation, invasion, migration and epithelial-mesenchymal transition of liver cancer cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1335-1346.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2024.11.001
| Primer | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| GAPDH | AATGGGCAGCCGTTAGGAAA | GCCCAATACGACCAAATCAGAG |
| CT57 | GAACATCGTGAACTACCTACCG | CAAGGGTGTCTCCGTGATGAT |
| ECAD | TCTTCAATCCCACCACGTACA | CTGGGGTATTGGGGGCATC |
| VIM | GACGCCATCAACACCGAGTT | CTTTGTCGTTGGTTAGCTGGT |
| OCLN | GGCACCTGCATACTCACCC | CTGGGAGAGCAACTCATCCTC |
| TWIST1 | GTCCGCAGTCTTACGAGGAG | GCTTGAGGGTCTGAATCTTGCT |
| MMP2 | TACAGGATCATTGGCTACACACC | GGTCACATCGCTCCAGACT |
| FOXM1 | CGTCGGCCACTGATTCTCAAA | GGCAGGGGATCTCTTAGGTTC |
| SNA | TCGGAAGCCTAACTACAGCGA | AGATGAGCATTGGCAGCGAG |
Tab 1 Primer sequences for qRT-PCR
| Primer | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| GAPDH | AATGGGCAGCCGTTAGGAAA | GCCCAATACGACCAAATCAGAG |
| CT57 | GAACATCGTGAACTACCTACCG | CAAGGGTGTCTCCGTGATGAT |
| ECAD | TCTTCAATCCCACCACGTACA | CTGGGGTATTGGGGGCATC |
| VIM | GACGCCATCAACACCGAGTT | CTTTGTCGTTGGTTAGCTGGT |
| OCLN | GGCACCTGCATACTCACCC | CTGGGAGAGCAACTCATCCTC |
| TWIST1 | GTCCGCAGTCTTACGAGGAG | GCTTGAGGGTCTGAATCTTGCT |
| MMP2 | TACAGGATCATTGGCTACACACC | GGTCACATCGCTCCAGACT |
| FOXM1 | CGTCGGCCACTGATTCTCAAA | GGCAGGGGATCTCTTAGGTTC |
| SNA | TCGGAAGCCTAACTACAGCGA | AGATGAGCATTGGCAGCGAG |
| 1 | LLOVET J M, KELLEY R K, VILLANUEVA A, et al. Hepatocellular carcinoma[J]. Nat Rev Dis Primers, 2021, 7(1): 6. |
| 2 | TANG A, HALLOUCH O, CHERNYAK V, et al. Epidemiology of hepatocellular carcinoma: target population for surveillance and diagnosis[J]. Abdom Radiol, 2018, 43(1): 13-25. |
| 3 | CHENG A L, KANG Y K, CHEN Z D, et al. Efficacy and safety of sorafenib in patients in the Asia-Pacific region with advanced hepatocellular carcinoma: a phase Ⅲ randomised, double-blind, placebo-controlled trial[J]. Lancet Oncol, 2009, 10(1): 25-34. |
| 4 | KIRKIN A F, DZHANDZHUGAZYAN K N, ZEUTHEN J. Cancer/testis antigens: structural and immunobiological properties[J]. Cancer Invest, 2002, 20(2): 222-236. |
| 5 | ALMEIDA L G, SAKABE N J, DEOLIVEIRA A R, et al. CTdatabase: a knowledge-base of high-throughput and curated data on cancer-testis antigens[J]. Nucleic Acids Res, 2009, 37(Database issue): D816-D819. |
| 6 | SIMPSON A J, CABALLERO O L, JUNGBLUTH A, et al. Cancer/testis antigens, gametogenesis and cancer[J]. Nat Rev Cancer, 2005, 5(8): 615-625. |
| 7 | CHENG W, LI H L, XI S Y, et al. Growth differentiation factor 1-induced tumour plasticity provides a therapeutic window for immunotherapy in hepatocellular carcinoma[J]. Nat Commun, 2021, 12(1): 7142. |
| 8 | KIM M C, BORCHERDING N, AHMED K K, et al. CD177 modulates the function and homeostasis of tumor-infiltrating regulatory T cells[J]. Nat Commun, 2021, 12(1): 5764. |
| 9 | DONG X Y, YANG X A, WANG Y D, et al. Zinc-finger protein ZNF165 is a novel cancer-testis antigen capable of eliciting antibody response in hepatocellular carcinoma patients[J]. Br J Cancer, 2004, 91(8): 1566-1570. |
| 10 | CHEN Y T, SCANLAN M J, VENDITTI C A, et al. Identification of cancer/testis-antigen genes by massively parallel signature sequencing[J]. Proc Natl Acad Sci U S A, 2005, 102(22): 7940-7945. |
| 11 | FAN S X, YAN S, YANG Y, et al. Actin-like protein 8 promotes the progression of triple-negative breast cancer via activating PI3K/AKT/mTOR pathway[J]. Onco Targets Ther, 2021, 14: 2463-2473. |
| 12 | WANG L F, XING X L, TIAN H, et al. Actin-like protein 8, a member of cancer/testis antigens, supports the aggressive development of oral squamous cell carcinoma cells via activating cell cycle signaling[J]. Tissue Cell, 2022, 75: 101708. |
| 13 | MA S W, WANG X W, ZHANG Z R, et al. Actin-like protein 8 promotes cell proliferation, colony-formation, proangiogenesis, migration and invasion in lung adenocarcinoma cells[J]. Thorac Cancer, 2020, 11(3): 526-536. |
| 14 | YANG P, QIAO Y N, MENG M, et al. Cancer/testis antigens as biomarker and target for the diagnosis, prognosis, and therapy of lung cancer[J]. Front Oncol, 2022, 12: 864159. |
| 15 | FREITAS M, MALHEIROS S, STÁVALE J N, et al. Expression of cancer/testis antigens is correlated with improved survival in glioblastoma[J]. Oncotarget, 2013, 4(4): 636-646. |
| 16 | LI B, ZHU J, MENG L. High expression of ACTL8 is poor prognosis and accelerates cell progression in head and neck squamous cell carcinoma[J]. Mol Med Rep, 2019, 19(2): 877-884. |
| 17 | MA S W, QIANG G L, SHAO W P, et al. Knockdown of actin-like 8 inhibits cell proliferation by regulating FOXM1, STMN1, PLK1, and BIRC5 in lung adenocarcinoma A549 cells[J]. Transl Cancer Res, 2019, 8(5): 1975-1984. |
| 18 | HAN Q, SUN M L, LIU W S, et al. Upregulated expression of ACTL8 contributes to invasion and metastasis and indicates poor prognosis in colorectal cancer[J]. Onco Targets Ther, 2019, 12: 1749-1763. |
| 19 | HUBER B E, THORGEIRSSON S S. Analysis of c-myc expression in a human hepatoma cell line[J]. Cancer Res, 1987, 47(13): 3414-3420. |
| 20 | CHEN Y P, CHAN A T C, LE Q T, et al. Nasopharyngeal carcinoma[J]. Lancet, 2019, 394(10192): 64-80. |
| 21 | HANAHAN D. Hallmarks of cancer: new dimensions[J]. Cancer Discov, 2022, 12(1): 31-46. |
| 22 | SERRANO-GOMEZ S J, MAZIVEYI M, ALAHARI S K. Regulation of epithelial-mesenchymal transition through epigenetic and post-translational modifications[J]. Mol Cancer, 2016, 15: 18. |
| 23 | SMITH B N, BHOWMICK N A. Role of EMT in metastasis and therapy resistance[J]. J Clin Med, 2016, 5(2): 17. |
| 24 | YE H, KELLY T F, SAMADANI U, et al. Hepatocyte nuclear factor 3/fork head homolog 11 is expressed in proliferating epithelial and mesenchymal cells of embryonic and adult tissues[J]. Mol Cell Biol, 1997, 17(3): 1626-1641. |
| 25 | KORVER W, ROOSE J, HEINEN K, et al. The human TRIDENT/HFH-11/FKHL16 gene: structure, localization, and promoter characterization[J]. Genomics, 1997, 46(3): 435-442. |
| 26 | MENG F D, WEI J C, QU K, et al. FoxM1 overexpression promotes epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma[J]. World J Gastroenterol, 2015, 21(1): 196-213. |
| 27 | YU M, TANG Z, MENG F D, et al. Elevated expression of FoxM1 promotes the tumor cell proliferation in hepatocellular carcinoma[J]. Tumour Biol, 2016, 37(1): 1289-1297. |
| 28 | BALLI D, USTIYAN V, ZHANG Y F, et al. Foxm1 transcription factor is required for lung fibrosis and epithelial-to-mesenchymal transition[J]. EMBO J, 2013, 32(2): 231-244. |
| 29 | WANG C R, WANG X J, SU Z J, et al. MiR-25 promotes hepatocellular carcinoma cell growth, migration and invasion by inhibiting RhoGDI1[J]. Oncotarget, 2015, 6(34): 36231-36244. |
| 30 | ZHANG N, WEI P, GONG A H, et al. FoxM1 promotes β-catenin nuclear localization and controls Wnt target-gene expression and glioma tumorigenesis[J]. Cancer Cell, 2011, 20(4): 427-442. |
| [1] | ZHU Zijun, QIAN Yife, LI Qianyu, LI Songling, QIN Wenli, LIU Yanfeng. Anaphase-promoting complex subunit 10 promotes hepatocellular carcinoma progression through regulation of the PI3K-AKT-mTOR signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1171-1182. |
| [2] | YANG Na, LIU Junli, BAI Jing, YANG Siyi, HAN Jiming, ZHANG Huahua. HENMT1 promotes the proliferation and migration of gastric cancer by activating the PI3K-AKT-mTOR signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(6): 717-726. |
| [3] | XU Muxin, LIU Xian, JIANG Lishan, SUN Qing. Promotion of Nd:YAP laser biostimulation on the proliferation and osteogenic differentiation of human periodontal ligament cells through WNT/β-catenin signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(5): 562-569. |
| [4] | CHEN Yinan, ZHENG Yang, ZENG Hanlin, LEI Ming. Mechanism of Fas-associated protein with death domain in promoting proliferation of head and neck squamous cell carcinoma cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(4): 404-414. |
| [5] | ZHANG Xianzhou, DU Fenglin, WU Lei, REN Yizhe, ZHAO Mingna, LOU Jiatao. Mechanistic study of OGT-promoted non-small cell lung cancer proliferation via the ERK signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1288-1297. |
| [6] | LI Xiang, WEI Ming, WU Wenxi, LUO Xiaoqin, YAO Biao, WU Siyu. Inhibitory effect of rutin on the growth and metastasis of osteosarcoma in vitro and in vivo [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 20-28. |
| [7] | SUN Chenwei, HAI Wangxi, QU Qian, XI Yun. [18F]F-FMISO and [18F]F-FLT PET/CT dual-nuclide imaging for in vivo prediction of drug resistance in pancreatic cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 60-68. |
| [8] | YANG Han, LEI Hao, XU Bide, WU Hao, MA Xunjun, HUANG Yanbo, MAO Yuanqing, ZHANG Jingwei, WANG Jinwu. Application of fluoroscopic stereophotogrammetric analysis in the detection of aseptic loosening of prostheses [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1061-1068. |
| [9] | SHI Lingling, CHENG Yanyong, ZHANG Lei. Effects of sevoflurane exposure on proliferation and differentiation of primary oligodendrocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1115-1123. |
| [10] | QIAN Liheng, WEN Kailing, LIAO Yingna, LI Shuxin, NIE Huizhen. Study on the effect and mechanism of sorting nexin 1 on inhibiting the proliferation and migration of colorectal cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1124-1135. |
| [11] | HAN Yishan, XU Ziqi, TAO Mengyu, FAN Guangjian, YU Bo. PRMT6 promotes the proliferation and migration of breast cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(8): 999-1010. |
| [12] | XUE Yu, ZHANG Hailong, LEI Ming. Expression of cancer-testis antigen SPANXB and its mechanism in affecting hepatocellular carcinoma progress [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 801-813. |
| [13] | YANG Shuwen, CHEN Juan, YANG Qin, LEI Ming, HUANG Chenhui. Study on the developmental function of CT14 using the model organism Caenorhabditis elegans [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 871-882. |
| [14] | TAN Lu, SHEN Shaoming, HE Ping. Function and mechanism study of hypoxia-induced long non-coding RNA 68 in hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(6): 702-712. |
| [15] | CAI Renjie, XU Ming. KHSRP regulates the responsiveness of prostate cancer cells to androgens through ANK3 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 417-426. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||