Promotive effect of cancer-testis antigen CT57 on proliferation, invasion, migration and epithelial-mesenchymal transition of liver cancer cells

doi:10.3969/j.issn.1674-8115.2024.11.001

Abstract

Abstract:

Objective ·To investigate the effect of cancer-testis antigen family member CT57 on proliferation, migration and invasion of the human liver cancer cells and tumorigenesis in nude mice, and the possible mechanism. Methods ·Bioinformatics methods were used to analyze the differential expression of CT57 in several cancer tissues and normal tissues, and its effect on the prognosis of liver cancer patients. Lentiviral vectors were used to establish liver cancer cell lines with stable knockdown and overexpression of CT57, which were confirmed by Western blotting. CCK-8 cell proliferation assay, soft agar colony formation assay and cell cycle experiment were used to detect the effect of CT57 on the proliferation and colony formation ability of liver cancer cells. Wound healing and Transwell assays were used to detect the effect of CT57 on the migration and invasion of liver cancer cells, and the expression of epithelial-mesenchymal transition (EMT) markers was detected by quantitative real-time PCR (qRT-PCR). To explore the effect of CT57 on liver cancer cells in vivo, CT57 knockdown liver cancer cells (experimental group) and control liver cancer cells (control group) were used to conduct subcutaneous tumor formation experiments in nude mice. Results ·Bioinformatics analysis of multiple tumors and corresponding normal tissues in The Cancer Genome Atlas Program (TCGA) database showed that CT57 was highly expressed in most tumor tissues, including liver cancer, and the expression level of CT57 was significantly correlated with the prognosis of liver cancer patients. Cell proliferation assay, soft agar colony formation assay, and cell cycle experiment showed that knockdown of CT57 inhibited the proliferation and colony formation of liver cancer cells and led to cell cycle arrest. In wound healing and Transwell assays, knockdown of CT57 inhibited the invasion and migration of liver cancer cells, while overexpression of CT57 promoted it. The results of qRT-PCR indicated that overexpression of CT57 resulted in downregulation of epithelial cell markers ECAD (E-cadherin) and OCLN (occludin), and upregulation of mesenchymal cell markers VIM (vimentin), TWIST1 (twist family bHLH transcription factor 1), and MMP2 (matrix metallopeptidase 2). In the in vivo experiments, knockdown of CT57 significantly reduced the tumor formation rate of liver cancer cells, tumor volume, and tumor weight in nude mice. Conclusion ·Knockdown of CT57 leads to cell cycle arrest, thereby inhibiting the proliferation of liver cancer cell and subcutaneous tumorigenesis in nude mice; CT57 promotes the invasion, migration and EMT of liver cancer cells.

Key words: cancer-testis antigen, liver cancer, cell proliferation, invasion, migration, epithelial-mesenchymal transition (EMT)

CLC Number:

R735.7

LUO Lange, ZHENG Chao, LEI Ming. Promotive effect of cancer-testis antigen CT57 on proliferation, invasion, migration and epithelial-mesenchymal transition of liver cancer cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1335-1346.

Figures/Tables 8

Tab 1 Primer sequences for qRT-PCR

Primer	Forward (5′→3′)	Reverse (5′→3′)
GAPDH	AATGGGCAGCCGTTAGGAAA	GCCCAATACGACCAAATCAGAG
CT57	GAACATCGTGAACTACCTACCG	CAAGGGTGTCTCCGTGATGAT
ECAD	TCTTCAATCCCACCACGTACA	CTGGGGTATTGGGGGCATC
VIM	GACGCCATCAACACCGAGTT	CTTTGTCGTTGGTTAGCTGGT
OCLN	GGCACCTGCATACTCACCC	CTGGGAGAGCAACTCATCCTC
TWIST1	GTCCGCAGTCTTACGAGGAG	GCTTGAGGGTCTGAATCTTGCT
MMP2	TACAGGATCATTGGCTACACACC	GGTCACATCGCTCCAGACT
FOXM1	CGTCGGCCACTGATTCTCAAA	GGCAGGGGATCTCTTAGGTTC
SNA	TCGGAAGCCTAACTACAGCGA	AGATGAGCATTGGCAGCGAG

Fig 1 Expression of CT57 in liver cancer tissues and cell lines and its relationship with patients′ prognosis

Fig 2 Effect of CT57 knockdown on proliferation and cell cycle in liver cancer cells

Fig 3 Changes in the proportion of Ki67-positive cells in liver cancer cells after knocking down CT57

Fig 4 Effect of CT57 knockdown on invasion and migration ability of liver cancer cells

Fig 5 Effect of CT57 overexpression on invasion and migration ability of liver cancer cells

Fig 6 Effect of CT57 overexpression on EMT in liver cancer cells

Fig 7 Effect of CT57 knockdown on subcutaneous tumor formation of liver cancer cells in nude mice

TrendMD

References 30

1	LLOVET J M, KELLEY R K, VILLANUEVA A, et al. Hepatocellular carcinoma[J]. Nat Rev Dis Primers, 2021, 7(1): 6.
2	TANG A, HALLOUCH O, CHERNYAK V, et al. Epidemiology of hepatocellular carcinoma: target population for surveillance and diagnosis[J]. Abdom Radiol, 2018, 43(1): 13-25.
3	CHENG A L, KANG Y K, CHEN Z D, et al. Efficacy and safety of sorafenib in patients in the Asia-Pacific region with advanced hepatocellular carcinoma: a phase Ⅲ randomised, double-blind, placebo-controlled trial[J]. Lancet Oncol, 2009, 10(1): 25-34.
4	KIRKIN A F, DZHANDZHUGAZYAN K N, ZEUTHEN J. Cancer/testis antigens: structural and immunobiological properties[J]. Cancer Invest, 2002, 20(2): 222-236.
5	ALMEIDA L G, SAKABE N J, DEOLIVEIRA A R, et al. CTdatabase: a knowledge-base of high-throughput and curated data on cancer-testis antigens[J]. Nucleic Acids Res, 2009, 37(Database issue): D816-D819.
6	SIMPSON A J, CABALLERO O L, JUNGBLUTH A, et al. Cancer/testis antigens, gametogenesis and cancer[J]. Nat Rev Cancer, 2005, 5(8): 615-625.
7	CHENG W, LI H L, XI S Y, et al. Growth differentiation factor 1-induced tumour plasticity provides a therapeutic window for immunotherapy in hepatocellular carcinoma[J]. Nat Commun, 2021, 12(1): 7142.
8	KIM M C, BORCHERDING N, AHMED K K, et al. CD177 modulates the function and homeostasis of tumor-infiltrating regulatory T cells[J]. Nat Commun, 2021, 12(1): 5764.
9	DONG X Y, YANG X A, WANG Y D, et al. Zinc-finger protein ZNF165 is a novel cancer-testis antigen capable of eliciting antibody response in hepatocellular carcinoma patients[J]. Br J Cancer, 2004, 91(8): 1566-1570.
10	CHEN Y T, SCANLAN M J, VENDITTI C A, et al. Identification of cancer/testis-antigen genes by massively parallel signature sequencing[J]. Proc Natl Acad Sci U S A, 2005, 102(22): 7940-7945.
11	FAN S X, YAN S, YANG Y, et al. Actin-like protein 8 promotes the progression of triple-negative breast cancer via activating PI3K/AKT/mTOR pathway[J]. Onco Targets Ther, 2021, 14: 2463-2473.
12	WANG L F, XING X L, TIAN H, et al. Actin-like protein 8, a member of cancer/testis antigens, supports the aggressive development of oral squamous cell carcinoma cells via activating cell cycle signaling[J]. Tissue Cell, 2022, 75: 101708.
13	MA S W, WANG X W, ZHANG Z R, et al. Actin-like protein 8 promotes cell proliferation, colony-formation, proangiogenesis, migration and invasion in lung adenocarcinoma cells[J]. Thorac Cancer, 2020, 11(3): 526-536.
14	YANG P, QIAO Y N, MENG M, et al. Cancer/testis antigens as biomarker and target for the diagnosis, prognosis, and therapy of lung cancer[J]. Front Oncol, 2022, 12: 864159.
15	FREITAS M, MALHEIROS S, STÁVALE J N, et al. Expression of cancer/testis antigens is correlated with improved survival in glioblastoma[J]. Oncotarget, 2013, 4(4): 636-646.
16	LI B, ZHU J, MENG L. High expression of ACTL8 is poor prognosis and accelerates cell progression in head and neck squamous cell carcinoma[J]. Mol Med Rep, 2019, 19(2): 877-884.
17	MA S W, QIANG G L, SHAO W P, et al. Knockdown of actin-like 8 inhibits cell proliferation by regulating FOXM1, STMN1, PLK1, and BIRC5 in lung adenocarcinoma A549 cells[J]. Transl Cancer Res, 2019, 8(5): 1975-1984.
18	HAN Q, SUN M L, LIU W S, et al. Upregulated expression of ACTL8 contributes to invasion and metastasis and indicates poor prognosis in colorectal cancer[J]. Onco Targets Ther, 2019, 12: 1749-1763.
19	HUBER B E, THORGEIRSSON S S. Analysis of c-myc expression in a human hepatoma cell line[J]. Cancer Res, 1987, 47(13): 3414-3420.
20	CHEN Y P, CHAN A T C, LE Q T, et al. Nasopharyngeal carcinoma[J]. Lancet, 2019, 394(10192): 64-80.
21	HANAHAN D. Hallmarks of cancer: new dimensions[J]. Cancer Discov, 2022, 12(1): 31-46.
22	SERRANO-GOMEZ S J, MAZIVEYI M, ALAHARI S K. Regulation of epithelial-mesenchymal transition through epigenetic and post-translational modifications[J]. Mol Cancer, 2016, 15: 18.
23	SMITH B N, BHOWMICK N A. Role of EMT in metastasis and therapy resistance[J]. J Clin Med, 2016, 5(2): 17.
24	YE H, KELLY T F, SAMADANI U, et al. Hepatocyte nuclear factor 3/fork head homolog 11 is expressed in proliferating epithelial and mesenchymal cells of embryonic and adult tissues[J]. Mol Cell Biol, 1997, 17(3): 1626-1641.
25	KORVER W, ROOSE J, HEINEN K, et al. The human TRIDENT/HFH-11/FKHL16 gene: structure, localization, and promoter characterization[J]. Genomics, 1997, 46(3): 435-442.
26	MENG F D, WEI J C, QU K, et al. FoxM1 overexpression promotes epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma[J]. World J Gastroenterol, 2015, 21(1): 196-213.
27	YU M, TANG Z, MENG F D, et al. Elevated expression of FoxM1 promotes the tumor cell proliferation in hepatocellular carcinoma[J]. Tumour Biol, 2016, 37(1): 1289-1297.
28	BALLI D, USTIYAN V, ZHANG Y F, et al. Foxm1 transcription factor is required for lung fibrosis and epithelial-to-mesenchymal transition[J]. EMBO J, 2013, 32(2): 231-244.
29	WANG C R, WANG X J, SU Z J, et al. MiR-25 promotes hepatocellular carcinoma cell growth, migration and invasion by inhibiting RhoGDI1[J]. Oncotarget, 2015, 6(34): 36231-36244.
30	ZHANG N, WEI P, GONG A H, et al. FoxM1 promotes β-catenin nuclear localization and controls Wnt target-gene expression and glioma tumorigenesis[J]. Cancer Cell, 2011, 20(4): 427-442.

[1]	YANG Han, LEI Hao, XU Bide, WU Hao, MA Xunjun, HUANG Yanbo, MAO Yuanqing, ZHANG Jingwei, WANG Jinwu. Application of fluoroscopic stereophotogrammetric analysis in the detection of aseptic loosening of prostheses [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1061-1068.
[2]	SHI Lingling, CHENG Yanyong, ZHANG Lei. Effects of sevoflurane exposure on proliferation and differentiation of primary oligodendrocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1115-1123.
[3]	QIAN Liheng, WEN Kailing, LIAO Yingna, LI Shuxin, NIE Huizhen. Study on the effect and mechanism of sorting nexin 1 on inhibiting the proliferation and migration of colorectal cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1124-1135.
[4]	HAN Yishan, XU Ziqi, TAO Mengyu, FAN Guangjian, YU Bo. PRMT6 promotes the proliferation and migration of breast cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(8): 999-1010.
[5]	XUE Yu, ZHANG Hailong, LEI Ming. Expression of cancer-testis antigen SPANXB and its mechanism in affecting hepatocellular carcinoma progress [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 801-813.
[6]	YANG Shuwen, CHEN Juan, YANG Qin, LEI Ming, HUANG Chenhui. Study on the developmental function of CT14 using the model organism Caenorhabditis elegans [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 871-882.
[7]	TAN Lu, SHEN Shaoming, HE Ping. Function and mechanism study of hypoxia-induced long non-coding RNA 68 in hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(6): 702-712.
[8]	CAI Renjie, XU Ming. KHSRP regulates the responsiveness of prostate cancer cells to androgens through ANK3 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 417-426.
[9]	AN Junyi, CHEN Biying, CHEN Xunrui, YIN Shanshan, BIAN Zhouliang, LIU Feng. SFXN3 expression in head and neck squamous cell carcinoma and its effect on cell proliferation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 427-434.
[10]	LI Huxiao, LI Xiaotian, ZHAO Xuri, ZHANG Huanyu, ZHOU Wei, SONG Zhongchen. Effects of gingipain extract on the biological characteristics of oral squamous cell carcinoma cell HN6 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 161-168.
[11]	CHEN Jin, FU Yao. Research progress in autologous regeneration of human corneal endothelial cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 775-780.
[12]	CHEN Ningdai, ZHOU Bingqian, CHEN Zheyi, CHEN Shiyu, ZHEN Yingxia. Effect of lysine demethylase 5C on renal carcinoma metastasis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 571-579.
[13]	CAO Yuan, WANG Hongxia, ZHU Ying, LI Junjian. Expression of tetraspanin 1 in breast cancer and its mechanism in promoting the progression of breast cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 293-300.
[14]	ZHANG Yin, WU Xian, XIE Bingluan, WANG Yi. Experience of laparoscopic ultrasound-guided ablation of diaphragmatic liver tumors [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 391-396.
[15]	YANG Wanli, SONG Juan, LI Bing, LAO Yimin. Deciphering the suppressive effects of CBX8 on prostate cancer cell invasion [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1507-1519.