SFXN3 expression in head and neck squamous cell carcinoma and its effect on cell proliferation

doi:10.3969/j.issn.1674-8115.2024.04.002

Abstract

Abstract:

Objective ·To analyze the expression of mitochondrial related gene SFXN3 (sideroflexin 3) in head and neck squamous cell carcinoma (HNSCC) and its effect on cell proliferation. Methods ·Mitochondrial related genes and TCGA-HNSCC dataset were obtained from public databases to identify the target gene SFXN3 by using bioinformatic methods. The expression of SFXN3 in HNSCC patient samples was analysed by using the UALCAN database, and survival analyses of patients with different SFXN3 expression levels were performed according to TCGA-HNSCC cohort and GEO cohorts (GSE65858, GSE41613 and GSE27020). By using TCGA-HNSCC cohort and GEO cohorts (GSE40020, GSE210287), the differences in SFXN3 expression levels between therapeutic responders and non-responders were compared. Quantitative real-time PCR (qRT-PCR) was used to verify the expression of SFXN3 in the collected HNSCC tumor and para-tumor tissues, and the expression level of SFXN3 in human normal oral epithelial cells and HNSCC tumor cell lines was detected. With the construction of stable-SFXN3-knockdown HNSCC cell lines, the effect of SFXN3 on the proliferation ability of HNSCC cells was observed by using the Incucyte live-cell imaging analysis system and plate colony formation assay. Transcriptome sequencing was performed on the total RNA of stably-SFXN3-knockdown cells and control cells, and pathway enrichment analysis was performed on the genes with differentially down-regulated expression in knockdown group compared with control group. Results ·SFXN3 was highly expressed in tumor tissues of HNSCC patients (P=0.000), and the prognosis of patients in the SFXN3-high-expression group was poor (all P<0.05). The expression level of SFXN3 in the non-responders was higher than that in the responders (P=0.008), indicating an unfavorable prognosis. High expression of SFXN3 was verified in the collected HNSCC tumor tissues and HNSCC cell lines (all P<0.05). After the knockdown of SFXN3 expression, the proliferation ability of HNSCC cells decreased, and the number of plate clones decreased (all P<0.05). RNA sequencing showed that the differentially expressed down-regulated genes in HNSCC cells in the SFXN3-knockdown group were enriched in DNA replication, cell cycle, mitochondrial translation, mitochondrial RNA metabolic process and mitochondrial gene expression pathways. Conclusion ·SFXN3 is highly expressed in HNSCC and it has negative correlation with the prognosis of patients. The proliferation ability and plate colony formation ability are inhibited in SFXN3-knockdown HNSCC cells, and these may work by affecting mitochondria function.

Key words: SFXN3, head and neck squamous cell carcinoma, mitochondria, cell proliferation

CLC Number:

AN Junyi, CHEN Biying, CHEN Xunrui, YIN Shanshan, BIAN Zhouliang, LIU Feng. SFXN3 expression in head and neck squamous cell carcinoma and its effect on cell proliferation[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 427-434.

Figures/Tables 7

Tab 1 Primer sequences for qRT-PCR （5′→3′）

Primer	Forward	Reverse
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG
ACTB	TGACGTGGACATCCGCAAAG	CTGGAAGGTGGACAGCGAGG
SFXN3	GGGTGAATTGCCTTTAGACATCA	GCAGCAGATTTCGAGGATCAGT

Tab 2 Primer sequences of shRNA （5′→3′）

Primer	Forward	Reverse
sh-SFXN3-1	GATCCGGCTGGGACCAAAGTACTTTCCCTCGAGGGAAAGTACTTTGGTCCCAGCCTTTTTTG	AATTCAAAAAAGGCTGGGACCAAAGTACTTTCCCTCGAGGGAAAGTACTTTGGTCCCAGCCG
sh-SFXN3-2	GATCCGCAGCGTTGAAGTGGTCTACTACTCGAGTAGTAGACCACTTCAACGCTGCTTTTTTG	AATTCAAAAAAGCAGCGTTGAAGTGGTCTACTACTCGAGTAGTAGACCACTTCAACGCTGCG

Fig 1 Identification of targeted gene SFXN3

Fig 2 High expression of SFXN3 in HNSCC and its significant association with poor prognosis

Fig 3 Establishment and verification of stable-SFXN3-knowdown HNSCC cell lines

Fig 4 Effect of SFXN3 knockdown on the proliferation of HNSCC cells

Fig 5 Pathway enrichment analysis of differentially expressed down-regulated genes in SFXN3-knockdown SCC9 cells

TrendMD

References 22

1	MODY M D, ROCCO J W, YOM S S, et al. Head and neck cancer[J]. Lancet, 2021, 398(10318): 2289-2299.
2	JOHNSON D E, BURTNESS B, LEEMANS C R, et al. Head and neck squamous cell carcinoma[J]. Nat Rev Dis Primers, 2020, 6(1): 92.
3	LEEMANS C R, BRAAKHUIS B J M, BRAKENHOFF R H. The molecular biology of head and neck cancer[J]. Nat Rev Cancer, 2011, 11(1): 9-22.
4	SUNG H, FERLAY J, SIEGEL R L, et al. Global cancer statistics 2020: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-249.
5	KORDBACHEH F, FARAH C S. Current and emerging molecular therapies for head and neck squamous cell carcinoma[J]. Cancers, 2021, 13(21): 5471.
6	PORPORATO P E, FILIGHEDDU N, PEDRO J M B S, et al. Mitochondrial metabolism and cancer[J]. Cell Res, 2018, 28(3): 265-280.
7	CHANG J J, WU H, WU J, et al. Constructing a novel mitochondrial-related gene signature for evaluating the tumor immune microenvironment and predicting survival in stomach adenocarcinoma[J]. J Transl Med, 2023, 21(1): 191.
8	FERLAY J, COLOMBET M, SOERJOMATARAM I, et al. Estimating the global cancer incidence and mortality in 2018: globocan sources and methods[J]. Int J Cancer, 2019, 144(8): 1941-1953.
9	ALSAHAFI E, BEGG K, AMELIO I, et al. Clinical update on head and neck cancer: molecular biology and ongoing challenges[J]. Cell Death Dis, 2019, 10(8): 540.
10	ABATE M, FESTA A, FALCO M, et al. Mitochondria as playmakers of apoptosis, autophagy and senescence[J]. Semin Cell Dev Biol, 2020, 98: 139-153.
11	KIM H K, NOH Y H, NILIUS B, et al. Current and upcoming mitochondrial targets for cancer therapy[J]. Semin Cancer Biol, 2017, 47: 154-167.
12	FLEMING M D, CAMPAGNA D R, HASLETT J N, et al. A mutation in a mitochondrial transmembrane protein is responsible for the pleiotropic hematological and skeletal phenotype of flexed-tail (f/f) mice[J]. Genes Dev, 2001, 15(6): 652-657.
13	TIFOUN N, DE LAS HERAS J M, GUILLAUME A, et al. Insights into the roles of the sideroflexins/SLC56 family in iron homeostasis and iron-sulfur biogenesis[J]. Biomedicines, 2021, 9(2): 103.
14	KORY N, WYANT G A, PRAKASH G, et al. SFXN1 is a mitochondrial serine transporter required for one-carbon metabolism[J]. Science, 2018, 362(6416): eaat9528.
15	JIN T F, GE L Q, CHEN J Q, et al. Identification of iron metabolism-related genes as prognostic indicators for papillary thyroid carcinoma: a retrospective study[J]. PeerJ, 2023, 11: e15592.
16	MURASE R, ABE Y, TAKEUCHI T, et al. Serum autoantibody to sideroflexin 3 as a novel tumor marker for oral squamous cell carcinoma[J]. Proteomics Clin Appl, 2008, 2(4): 517-527.
17	CHEN K L, GONG S, FANG X L, et al. Non-coding RNA-mediated high expression of SFXN3 as a prognostic biomarker associated with paclitaxel resistance and immunosuppressive microenvironment in head and neck cancer[J]. Front Immunol, 2022, 13: 920136.
18	ZHENG D Y, LUO S W, WANG S, et al. Construction of a competing endogenous RNA network in head and neck squamous cell carcinoma by pan-cancer analysis[J]. Transl Cancer Res, 2022, 11(9): 3050-3063.
19	CRISCUOLO D, AVOLIO R, MATASSA D S, et al. Targeting mitochondrial protein expression as a future approach for cancer therapy[J]. Front Oncol, 2021, 11: 797265.
20	PU M, WANG J L, HUANG Q K, et al. High MRPS23 expression contributes to hepatocellular carcinoma proliferation and indicates poor survival outcomes[J]. Tumour Biol, 2017, 39(7): 1010428317709127.
21	ZHU P, LIU Y Z, ZHANG F L, et al. Human elongation factor 4 regulates cancer bioenergetics by acting as a mitochondrial translation switch[J]. Cancer Res, 2018, 78(11): 2813-2824.
22	DELAUNAY S, PASCUAL G, FENG B H, et al. Mitochondrial RNA modifications shape metabolic plasticity in metastasis[J]. Nature, 2022, 607(7919): 593-603.

[1]	CAI Renjie, XU Ming. KHSRP regulates the responsiveness of prostate cancer cells to androgens through ANK3 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 417-426.
[2]	LI Huxiao, LI Xiaotian, ZHAO Xuri, ZHANG Huanyu, ZHOU Wei, SONG Zhongchen. Effects of gingipain extract on the biological characteristics of oral squamous cell carcinoma cell HN6 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 161-168.
[3]	Aishanjiang Kedeerya, FU Yi, LAI Donglin, WU Hailong, GONG Wei. An integrated prognostic model of nuclear-encoded mitochondrial gene signature and clinical information for hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(1): 1-12.
[4]	JIN Fangquan, FAN Chenghu, TANG Xiaodong, CHEN Yantong, QI Bingxian. Research progress in the relationship between mitochondrial dysfunction and osteoporosis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 761-767.
[5]	CHEN Jin, FU Yao. Research progress in autologous regeneration of human corneal endothelial cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 775-780.
[6]	HONG Hanxin, WANG Longhao, LIU Huihui, PENG Hu, WU Hao, YANG Tao. Construction of translocase of inner mitochondrial membrane 8A gene knockout mice and study of its inner ear function [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 261-268.
[7]	LIU Tiexin, LIN Junqing, ZHENG Xianyou. Research progress of subcellular structure-targeted therapy in spinal cord injury [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(2): 230-236.
[8]	SHA Xudong, WANG Chenfei, LU Jia, YU Zhihua. Regulation of high-fat diet-induced microglial metabolism by transient receptor potential vanilloid type 1 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1493-1506.
[9]	YANG Wanli, SONG Juan, LI Bing, LAO Yimin. Deciphering the suppressive effects of CBX8 on prostate cancer cell invasion [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1507-1519.
[10]	XIE Lin, CHENG Ye, ZHENG Qimin, ZHANG Xi, FU Lili, CHEN Min, WANG Yi, MEI Changlin, XIE Jingyuan, GU Xiangchen. Preventive effect of icariin on transition from acute kidney injury to chronic kidney disease in mouse model [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 8-19.
[11]	FENG Baoyi, DONG Tingting, ZHENG Xiaofei, TAO Yong, WU Hao. Comparison of mitochondria and NAD⁺ level in the murine cochleae of C57BL/6J mice at different ages [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 980-986.
[12]	DING He, CAO Yanglin, HE Yang, WEI Xing, YANG Jianfeng. SMAD7 expression in multiple myeloma and its effect on cell proliferation and drug resistance [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 858-865.
[13]	HU Zhexuan, ZHANG Xin, WO Lulu, LI Jingchi, WANG Jiao, ZHOU Cixiang, ZHAO Qian. Study on the function of TRMT61A in liver cancer cell and its mechanism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 742-750.
[14]	XU Feixiang, WANG Sheng, XUE Mingming, TONG Chaoyang, CHEN Yumei. Effect of altered expression of long non-coding RNA-B230352I09 on proliferation and cycle of H9C2 cardiomyocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 578-582.
[15]	LIN Yijia, CHENG Lizhen, MIAO Ya. Research progress in the role and mechanism of abnormal mitophagy in Alzheimer's disease [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 387-392.