Regulation of high-fat diet-induced microglial metabolism by transient receptor potential vanilloid type 1

doi:10.3969/j.issn.1674-8115.2023.12.004

Abstract

Abstract:

Objective ·Transcriptomic and lipidomic analysis techniques were used to investigate the role of transient receptor potential vanilloid type 1 (TRPV1) channel activation in the regulation of high-fat diet-induced microglial metabolism. Methods ·Eight-week-old C57BL/6J mice (WT) and Trpv1^-/- (KO) mice were used as experimental animals, and fed high-fat diet (HFD) for 3 days, 7 days, and 8 weeks to induce modelling (WT and KO groups, n = 3; WT-HFD and KO-HFD groups, n = 4). TRPV1 channel expression and cellular localisation were measured by immunofluorescence in the brains of mice in the WT-HFD and KO-HFD group. RNA sequencing and liquid chromatography-mass spectrometry were performed to determine the brain phenotype of mice in the WT-HFD and KO-HFD groups. Results ·The expression level of Trpv1 mRNA in microglia was significantly increased in mice in the WT-HFD group compared to mice in the WT group. The expression levels of genes related to brain lipid metabolism, mitochondrial function, glucose transfer, and glycolysis were down-regulated in the KO-HFD group of mice compared with the WT-HFD group of mice. Lipidomic analysis showed that although lipids accumulated in the brain tissue of mice in the KO-HFD group, Trpv1 knockdown attenuated HFD-induced microglia activation, and in addition the TRPV1 agonist capsaicin attenuated palmitate-induced depolarisation of mitochondrial membrane potential in vitro. Conclusion ·Together, these findings suggest that TRPV1 regulates lipid and glucose metabolism in microglia via fuel availability driven by a mitochondrial mechanism.

Key words: transient receptor potential vanilloid type 1(TRPV1), microglia, metabolism, lipid, mitochondria

CLC Number:

R964

SHA Xudong, WANG Chenfei, LU Jia, YU Zhihua. Regulation of high-fat diet-induced microglial metabolism by transient receptor potential vanilloid type 1[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1493-1506.

Figures/Tables 8

Tab 1 Primer sequences used for qRT-PCR （5'→3'）

Oligonucleotide	SOURCE	IDENTIFIER
mouse trpv1 FWD: TGGCTCATATTTGCCTTCAG mouse trpv1 REV: CAGCCCTAGGAGTTGATFGA	Sango Biotech	N/A
mouse ucp2 FWD: GCTGGTGGTTCGGAGAT mouse ucp2 REV: TGAAGTGGCAAGGGAGG	Sango Biotech	N/A
mouse tnf-α FWD: CAGGAGGGAGAACAGAAACTCCA mouse tnf-α REV: CCTGGTTGGCTGCTT	Sango Biotech	N/A
mouse il-1β FWD: GGAGGTGGTGATAGCCGGTAT mouse il-1β REV: TGGGTAATCCATAGAGCCCAG	Sango Biotech	N/A
mouse gapdh FWD: TGATGGCAACAATCTCCAC mouse gapdh REV: CGTCCCGTAGACAAAATGGT	Sango Biotech	N/A

Fig 1 WGCNA in WT and genetic Trpv1 deletion mice before and after high fat feeding

Fig 2 HFD induced liposome switch of brain cells with Trpv1 deficiency

Fig 3 Genetic Trpv1 deletion reduced HFD-induced multiple effects on brain transcriptome

Fig 4 Genetic Trpv1 deletion reduced HFD-induced multiple effects on metabolic pathways of the brain

Fig 5 Genetic Trpv1 deletion ameliorates HFD-induced microglia activation

Fig 6 Up-regulation of TRPV1 in active microglia and reactive astrocytes of HFD mice brains

Fig 7 Genetic Trpv1 deletion attenuate HFD-induced neuroinflammation and mitochondrial activation

TrendMD

References 49

1	SANDOVAL D A, OBICI S, SEELEY R J. Targeting the CNS to treat type 2 diabetes[J]. Nat Rev Drug Discov, 2009, 8(5): 386-398.
2	HORVATH T L, SARMAN B, GARCÍA-CÁCERES C, et al. Synaptic input organization of the melanocortin system predicts diet-induced hypothalamic reactive gliosis and obesity[J]. Proc Natl Acad Sci USA, 2010, 107(33): 14875-14880.
3	VALDEARCOS M, DOUGLASS J D, ROBBLEE M M, et al. Microglial inflammatory signaling orchestrates the hypothalamic immune response to dietary excess and mediates obesity susceptibility[J]. Cell Metab, 2018, 27(6): 1356.
4	KIM J D, YOON N A, JIN S, et al. Microglial UCP₂ mediates inflammation and obesity induced by high-fat feeding[J]. Cell Metab, 2019, 30(5): 952-962.e5.
5	CATERINA M J, SCHUMACHER M A, TOMINAGA M, et al. The capsaicin receptor: a heat-activated ion channel in the pain pathway[J]. Nature, 1997, 389(6653): 816-824.
6	MARRONE M C, MORABITO A, GIUSTIZIERI M, et al. TRPV1 channels are critical brain inflammation detectors and neuropathic pain biomarkers in mice[J]. Nat Commun, 2017, 8: 15292.
7	GIBSON H E, EDWARDS J G, PAGE R S, et al. TRPV1 channels mediate long-term depression at synapses on hippocampal interneurons[J]. Neuron, 2008, 57(5): 746-759.
8	MARINELLI S, MARZO V, BERRETTA N, et al. Presynaptic facilitation of glutamatergic synapses to dopaminergic neurons of the rat substantia nigra by endogenous stimulation of vanilloid receptors[J]. J Neurosci, 2003, 23(8): 3136-3144.
9	DOYLE M W, BAILEY T W, JIN Y H, et al. Vanilloid receptors presynaptically modulate cranial visceral afferent synaptic transmission in nucleus tractus solitarius[J]. J Neurosci, 2002, 22(18): 8222-8229.
10	EDWARDS J G. TRPV1 in the central nervous system: synaptic plasticity, function, and pharmacological implications[J]. Prog Drug Res, 2014, 68: 77-104.
11	KIM S R, KIM S U, OH U, et al. Transient receptor potential vanilloid subtype 1 mediates microglial cell death in vivo and in vitro via Ca²⁺-mediated mitochondrial damage and cytochrome c release[J]. J Immunol, 2006, 177(7): 4322-4329.
12	HASSAN S, ELDEEB K, MILLNS P J, et al. Cannabidiol enhances microglial phagocytosis via transient receptor potential (TRP) channel activation[J]. Br J Pharmacol, 2014, 171(9): 2426-2439.
13	MIYAKE T, SHIRAKAWA H, NAKAGAWA T, et al. Activation of mitochondrial transient receptor potential vanilloid 1 channel contributes to microglial migration[J]. Glia, 2015, 63(10): 1870-1882.
14	SAPPINGTON R M, CALKINS D J. Contribution of TRPV1 to microglia-derived IL-6 and NFkappaB translocation with elevated hydrostatic pressure[J]. Invest Ophthalmol Vis Sci, 2008, 49(7): 3004-3017.
15	SCHILLING T, EDER C. Importance of the non-selective cation channel TRPV1 for microglial reactive oxygen species generation[J]. J Neuroimmunol, 2009, 216(1/2): 118-121.
16	GAO W, SUN Y H, CAI M, et al. Copper sulfide nanoparticles as a photothermal switch for TRPV1 signaling to attenuate atherosclerosis[J]. Nat Commun, 2018, 9(1): 231.
17	BASKARAN P, KRISHNAN V, REN J, et al. Capsaicin induces browning of white adipose tissue and counters obesity by activating TRPV1 channel-dependent mechanisms[J]. Br J Pharmacol, 2016, 173(15): 2369-2389.
18	WEI T J, WANG Y X, XU W R, et al. KCa_3.1 deficiency attenuates neuroinflammation by regulating an astrocyte phenotype switch involving the PI3K/AKT/GSK3β pathway[J]. Neurobiol Dis, 2019, 132: 104588.
19	ZHANG B, HORVATH S. A general framework for weighted gene co-expression network analysis[J]. Stat Appl Genet Mol Biol, 2005, 4: Article17.
20	LANGFELDER P, HORVATH S. WGCNA: an R package for weighted correlation network analysis[J]. BMC Bioinformatics, 2008, 9: 559.
21	SHANNON P, MARKIEL A, OZIER O, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks[J]. Genome Res, 2003, 13(11): 2498-2504.
22	ZHOU Y Y, ZHOU B, PACHE L, et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets[J]. Nat Commun, 2019, 10(1): 1523.
23	FALK T, YUE X, ZHANG S L, et al. Vascular endothelial growth factor-B is neuroprotective in an in vivo rat model of Parkinson's disease[J]. Neurosci Lett, 2011, 496(1): 43-47.
24	KORDOWER J H, EMBORG M E, BLOCH J, et al. Neurodegeneration prevented by lentiviral vector delivery of GDNF in primate models of Parkinson's disease[J]. Science, 2000, 290(5492): 767-773.
25	ARENA E T, RUEDEN C T, HINER M C, et al. Quantitating the cell: turning images into numbers with ImageJ[J]. Wiley Interdiscip Rev Dev Biol, 2017, 6(2): 10.1002/wdev.260.
26	TRIEBL A, TRÖTZMÜLLER M, HARTLER J, et al. Lipidomics by ultrahigh performance liquid chromatography-high resolution mass spectrometry and its application to complex biological samples[J]. J Chromatogr B Analyt Technol Biomed Life Sci, 2017, 1053: 72-80.
27	DIRCKS L, SUL H S. Acyltransferases of de novo glycerophospholipid biosynthesis[J]. Prog Lipid Res, 1999, 38(5/6): 461-479.
28	TRACEY T J, STEYN F J, WOLVETANG E J, et al. Neuronal lipid metabolism: multiple pathways driving functional outcomes in health and disease[J]. Front Mol Neurosci, 2018, 11: 10.
29	LEPROPRE S, KAUTBALLY S, OCTAVE M, et al. AMPK-ACC signaling modulates platelet phospholipids and potentiates thrombus formation[J]. Blood, 2018, 132(11): 1180-1192.
30	VANCE J E. Phospholipid synthesis and transport in mammalian cells[J]. Traffic, 2015, 16(1): 1-18.
31	MONNI M, CORAZZI L, MIGLIORATI G, et al. Respiratory state and phosphatidylserine import in brain mitochondria in vitro[J]. J Membrane Biol, 2000, 173(2): 97-105.
32	THOMAS H E, ZHANG Y, STEFELY J A, et al. Mitochondrial complex I activity is required for maximal autophagy[J]. Cell Rep, 2018, 24(9): 2404-2417.e8.
33	SHAHID R A, VIGNA S R, LAYNE A C, et al. Acinar cell production of leukotriene B₄ contributes to development of neurogenic pancreatitis in mice[J]. Cell Mol Gastroenterol Hepatol, 2015, 1(1): 75-86.
34	MA L Q, ZHONG J, ZHAO Z G, et al. Activation of TRPV1 reduces vascular lipid accumulation and attenuates atherosclerosis[J]. Cardiovasc Res, 2011, 92(3): 504-513.
35	LI L, CHEN J, NI Y X, et al. TRPV1 activation prevents nonalcoholic fatty liver through UCP₂ upregulation in mice[J]. Pflugers Arch - Eur J Physiol, 2012, 463(5): 727-732.
36	ZHAO J F, CHING L C, KOU Y R, et al. Activation of TRPV1 prevents OxLDL-induced lipid accumulation and TNF-α-induced inflammation in macrophages: role of liver X receptor Α[J]. Mediators Inflamm, 2013, 2013: 925171.
37	TANG W, FAN Y Y. SIRT6 as a potential target for treating insulin resistance[J]. Life Sci, 2019, 231: 116558.
38	LEE E, JUNG D Y, KIM J H, et al. Transient receptor potential vanilloid type-1 channel regulates diet-induced obesity, insulin resistance, and leptin resistance[J]. FASEB J, 2015, 29(8): 3182-3192.
39	RAZAVI R, CHAN Y, AFIFIYAN F N, et al. TRPV¹⁺ sensory neurons control beta cell stress and islet inflammation in autoimmune diabetes[J]. Cell, 2006, 127(6): 1123-1135.
40	GUILLEMOT-LEGRIS O, MUCCIOLI G G. Obesity-induced neuroinflammation: beyond the hypothalamus[J]. Trends Neurosci, 2017, 40(4): 237-253.
41	KETTENMANN H, HANISCH U K, NODA M, et al. Physiology of microglia[J]. Physiol Rev, 2011, 91(2): 461-553.
42	FERNANDES E S, BRITO C X L, TEIXEIRA S A, et al. TRPV1 antagonism by capsazepine modulates innate immune response in mice infected with Plasmodium berghei ANKA[J]. Mediators Inflamm, 2014, 2014: 506450.
43	MANES T D, WANG V, POBER J S. Divergent TCR-initiated calcium signals govern recruitment versus activation of human alloreactive effector memory T cells by endothelial cells[J]. J Immunol, 2018, 201(11): 3167-3174.
44	HUANG W X, YU F, SANCHEZ R M, et al. TRPV1 promotes repetitive febrile seizures by pro-inflammatory cytokines in immature brain[J]. Brain Behav Immun, 2015, 48: 68-77.
45	YOSHIDA A, FURUBE E, MANNARI T, et al. TRPV1 is crucial for proinflammatory STAT3 signaling and thermoregulation-associated pathways in the brain during inflammation[J]. Sci Rep, 2016, 6: 26088.
46	CHEN Y, WILLCOCKSON H H, VALTSCHANOFF J G. Influence of the vanilloid receptor TRPV1 on the activation of spinal cord glia in mouse models of pain[J]. Exp Neurol, 2009, 220(2): 383-390.
47	HO K W, WARD N J, CALKINS D J. TRPV1: a stress response protein in the central nervous system[J]. Am J Neurodegener Dis, 2012, 1(1): 1-14.
48	KONG W L, PENG Y Y, PENG B W. Modulation of neuroinflammation: role and therapeutic potential of TRPV1 in the neuro-immune axis[J]. Brain Behav Immun, 2017, 64: 354-366.
49	LEONELLI M, MARTINS D O, BRITTO L R G. TRPV1 receptors are involved in protein nitration and Müller cell reaction in the acutely axotomized rat retina[J]. Exp Eye Res, 2010, 91(5): 755-768.

[1]	LU Xiaobing, YUE Jiang, HE Shengyun, DONG Ying, LU Qing, MA Jing. Effect of intramuscular adipose tissue in the skeletal muscle of thigh on glucose metabolism in male patients with obesity [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(9): 1169-1174.
[2]	GAO Yu, YIN Shan, PANG Yue, LIANG Wenyi, LIU Yumin. Effect of rhubarb on gut microbiota-host co-metabolism in rats [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(8): 997-1007.
[3]	ZHU Xiaochen, XIE Xinyi, ZHAO Xuri, XU Lina, HE Zhiyan, ZHOU Wei. Construction and characterization of mice with conditional knockout of Stat3 gene in microglia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 689-698.
[4]	JIN Fangquan, FAN Chenghu, TANG Xiaodong, CHEN Yantong, QI Bingxian. Research progress in the relationship between mitochondrial dysfunction and osteoporosis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 761-767.
[5]	MA Zhuoran, YUAN Ancai, JIANG Huiru, CHEN Xiaoyu, ZHANG Wei, PU Jun. Meta analysis of correlation between lipid accumulation product and hypertension in Chinese adults [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(4): 466-473.
[6]	HONG Hanxin, WANG Longhao, LIU Huihui, PENG Hu, WU Hao, YANG Tao. Construction of translocase of inner mitochondrial membrane 8A gene knockout mice and study of its inner ear function [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 261-268.
[7]	CHEN Chen, CHENG Zhuoan, WANG Cun, XIA Qiang. Research progress in ferroptosis regulation in the treatment of liver diseases [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 365-373.
[8]	LIU Tiexin, LIN Junqing, ZHENG Xianyou. Research progress of subcellular structure-targeted therapy in spinal cord injury [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(2): 230-236.
[9]	XIE Xiaolei, JIANG Peixin, ZHANG Jinghong, MO Junjian, WU Kefan, ZENG Kangyi. A review of RIZ1 regulation of the signal pathways in obesity and tumors [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 114-119.
[10]	XIE Lin, CHENG Ye, ZHENG Qimin, ZHANG Xi, FU Lili, CHEN Min, WANG Yi, MEI Changlin, XIE Jingyuan, GU Xiangchen. Preventive effect of icariin on transition from acute kidney injury to chronic kidney disease in mouse model [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 8-19.
[11]	WANG Dayuan, XU Jianrong, JIANG Gan, SONG Qingxiang, CHEN Jun, SONG Huahua, GU Xiao, GAO Xiaoling. Effect of α-mangostin on amyotrophic lateral sclerosis and its mechanism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1265-1274.
[12]	WANG Jie, WU Hui, LU Lingpeng, YANG Kefeng, ZHU Jie, ZHOU Hengyi, YAO Die, GAO Ya, FENG Yuting, LIU Yuhong, JIA Jie. Dynamic changes in gut microbiota of women with gestational diabetes mellitus and the correlation with blood glucose, blood lipid and diet [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1336-1346.
[13]	FENG Baoyi, DONG Tingting, ZHENG Xiaofei, TAO Yong, WU Hao. Comparison of mitochondria and NAD⁺ level in the murine cochleae of C57BL/6J mice at different ages [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 980-986.
[14]	ZHENG Shifan, MA Jiao. Research progress in the role of cancer stem cell metabolism in tumor development [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 825-832.
[15]	LIN Yijia, CHENG Lizhen, MIAO Ya. Research progress in the role and mechanism of abnormal mitophagy in Alzheimer's disease [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 387-392.