Journal of Shanghai Jiao Tong University (Medical Science) ›› 2024, Vol. 44 ›› Issue (11): 1370-1382.doi: 10.3969/j.issn.1674-8115.2024.11.004
• Basic research • Previous Articles
GAO Kexing(), LIAO Chunhua, LI Shengze, MA Shuangyu, HUANG Lei()
Received:
2024-02-11
Accepted:
2024-03-22
Online:
2024-11-28
Published:
2024-11-28
Contact:
HUANG Lei
E-mail:xingke_gao@163.com;leihuang@shsmu.edu.cn
Supported by:
CLC Number:
GAO Kexing, LIAO Chunhua, LI Shengze, MA Shuangyu, HUANG Lei. Functional site analysis of mucin 1 in regulating the malignant characteristics of tumor cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1370-1382.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2024.11.004
Primer | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
AQA | GCCTTGGCTGTCGCTCAGGCCCGCCGAAAGAAC | GTTCTTTCGGCGGGCCTGAGCGACAGCCAAGGC |
S251R | CCTCCAATCACAGGACTTCTCCCCAG | CTGGGGAGAAGTCCTGTGATTGGAGG |
N271S | TTCACATTTCAAGCCTCCAGTTTAATT | AATTAAACTGGAGGCTTGAAATGTGAA |
V359I | ACGATCTCAGACATCAGCGTGAGTGAT | ATCACTCACGCTTACGTCTGAGATCGT |
P418S | CAGCTGGACATCTTTTCAGCCCGGGAT | ATCCCGGGCTGAAAAGATGTCCAGCTG |
N465H | TCTTACACACACCCAGCAGTGGCAGCC | GGCTGCCACTGCTGGGTGTGTGTAAGA |
Tab 1 Primer sequences for PCR
Primer | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
AQA | GCCTTGGCTGTCGCTCAGGCCCGCCGAAAGAAC | GTTCTTTCGGCGGGCCTGAGCGACAGCCAAGGC |
S251R | CCTCCAATCACAGGACTTCTCCCCAG | CTGGGGAGAAGTCCTGTGATTGGAGG |
N271S | TTCACATTTCAAGCCTCCAGTTTAATT | AATTAAACTGGAGGCTTGAAATGTGAA |
V359I | ACGATCTCAGACATCAGCGTGAGTGAT | ATCACTCACGCTTACGTCTGAGATCGT |
P418S | CAGCTGGACATCTTTTCAGCCCGGGAT | ATCCCGGGCTGAAAAGATGTCCAGCTG |
N465H | TCTTACACACACCCAGCAGTGGCAGCC | GGCTGCCACTGCTGGGTGTGTGTAAGA |
Mutant | Cancer type | Location | Frequency/% |
---|---|---|---|
P418S | Lung squamous cell carcinoma | CD | 5.19 |
T112P | Bladder urothelial carcinoma/pancreatic adenocarcinoma | N1 | 4.55 |
P134A | Pancreatic adenocarcinoma/melanoma | VNTR | 3.90 |
S251R | Esophagogastric cancer/stomach adenocarcinoma | N2 | 2.60 |
V359I | Colorectal adenocarcinoma/breast invasive carcinoma | ED | 2.60 |
G33R | Cutaneous squamous cell carcinoma | N1 | 1.95 |
S55N | Uterine corpus endometrial carcinoma | N1 | 1.95 |
P102L | Stomach adenocarcinoma | N1 | 1.95 |
N271S | Breast invasive carcinoma | SEA | 1.95 |
G305D | Stomach adenocarcinoma | SEA | 1.95 |
D336Y | Lung adenocarcinoma | SEA | 1.95 |
V359F | Breast invasive carcinoma | ED | 1.95 |
P418L | Cutaneous squamous cell carcinoma | CD | 1.95 |
N465H | Uterine corpus endometrioid carcinoma | CD | 1.95 |
Tab 2 Information of 14 MUC1 mutants with high frequency
Mutant | Cancer type | Location | Frequency/% |
---|---|---|---|
P418S | Lung squamous cell carcinoma | CD | 5.19 |
T112P | Bladder urothelial carcinoma/pancreatic adenocarcinoma | N1 | 4.55 |
P134A | Pancreatic adenocarcinoma/melanoma | VNTR | 3.90 |
S251R | Esophagogastric cancer/stomach adenocarcinoma | N2 | 2.60 |
V359I | Colorectal adenocarcinoma/breast invasive carcinoma | ED | 2.60 |
G33R | Cutaneous squamous cell carcinoma | N1 | 1.95 |
S55N | Uterine corpus endometrial carcinoma | N1 | 1.95 |
P102L | Stomach adenocarcinoma | N1 | 1.95 |
N271S | Breast invasive carcinoma | SEA | 1.95 |
G305D | Stomach adenocarcinoma | SEA | 1.95 |
D336Y | Lung adenocarcinoma | SEA | 1.95 |
V359F | Breast invasive carcinoma | ED | 1.95 |
P418L | Cutaneous squamous cell carcinoma | CD | 1.95 |
N465H | Uterine corpus endometrioid carcinoma | CD | 1.95 |
1 | KUFE D W. Mucins in cancer: function, prognosis and therapy[J]. Nat Rev Cancer, 2009, 9(12): 874-885. |
2 | ANDRIANIFAHANANA M, MONIAUX N, BATRA S K. Regulation of mucin expression: mechanistic aspects and implications for cancer and inflammatory diseases[J]. Biochim Biophys Acta, 2006, 1765(2): 189-222. |
3 | MONIAUX N, ANDRIANIFAHANANA M, BRAND R E, et al. Multiple roles of mucins in pancreatic cancer, a lethal and challenging malignancy[J]. Br J Cancer, 2004, 91(9): 1633-1638. |
4 | GAEMERS I C, VOS H L, VOLDERS H H, et al. A STAT-responsive element in the promoter of the episialin/MUC1 gene is involved in its overexpression in carcinoma cells[J]. J Biol Chem, 2001, 276(9): 6191-6199. |
5 | SHENG Y H, LOURIE R, LINDÉN S K, et al. The MUC13 cell-surface mucin protects against intestinal inflammation by inhibiting epithelial cell apoptosis[J]. Gut, 2011, 60(12): 1661-1670. |
6 | SINGH A P, MONIAUX N, CHAUHAN S C, et al. Inhibition of MUC4 expression suppresses pancreatic tumor cell growth and metastasis[J]. Cancer Res, 2004, 64(2): 622-630. |
7 | NATH S, MUKHERJEE P. MUC1: a multifaceted oncoprotein with a key role in cancer progression[J]. Trends Mol Med, 2014, 20(6): 332-342. |
8 | CHEN W Q, ZHANG Z, ZHANG S Q, et al. MUC1: structure, function, and clinic application in epithelial cancers[J]. Int J Mol Sci, 2021, 22(12): 6567. |
9 | HATTRUP C L, GENDLER S J. Structure and function of the cell surface (tethered) mucins[J]. Annu Rev Physiol, 2008, 70: 431-457. |
10 | LEVITIN F, STERN O, WEISS M, et al. The MUC1 SEA module is a self-cleaving domain[J]. J Biol Chem, 2005, 280(39): 33374-33386. |
11 | CARSON D D. The cytoplasmic tail of MUC1: a very busy place[J]. Sci Signal, 2008, 1(27): pe35. |
12 | KUFE D W. MUC1-C in chronic inflammation and carcinogenesis; emergence as a target for cancer treatment[J]. Carcinogenesis, 2020, 41(9): 1173-1183. |
13 | LENG Y M, CAO C, REN J, et al. Nuclear import of the MUC1-C oncoprotein is mediated by nucleoporin Nup62[J]. J Biol Chem, 2007, 282(27): 19321-19330. |
14 | RAINA D, AHMAD R, RAJABI H, et al. Targeting cysteine-mediated dimerization of the MUC1-C oncoprotein in human cancer cells[J]. Int J Oncol, 2012, 40(5): 1643-1649. |
15 | VAN PUTTEN J P M, STRIJBIS K. Transmembrane mucins: signaling receptors at the intersection of inflammation and cancer[J]. J Innate Immun, 2017, 9(3): 281-299. |
16 | YOLKEN R H, PETERSON J A, VONDERFECHT S L, et al. Human milk mucin inhibits rotavirus replication and prevents experimental gastroenteritis[J]. J Clin Invest, 1992, 90(5): 1984-1991. |
17 | LAU S K, WEISS L M, CHU P G. Differential expression of MUC1, MUC2, and MUC5AC in carcinomas of various sites: an immunohistochemical study[J]. Am J Clin Pathol, 2004, 122(1): 61-69. |
18 | KASHYAP B, KULLAA A M. Regulation of mucin 1 expression and its relationship with oral diseases[J]. Arch Oral Biol, 2020, 117: 104791. |
19 | SAFI F, KOHLER I, RÖTTINGER E, et al. The value of the tumor marker CA 15-3 in diagnosing and monitoring breast cancer[J]. Cancer, 1991, 68(3): 574-582. |
20 | STEINBERG W. The clinical utility of the CA 19-9 tumor-associated antigen[J]. Am J Gastroenterol, 1990, 85(4): 350-355. |
21 | SUPRUNIUK K, RADZIEJEWSKA I. MUC1 is an oncoprotein with a significant role in apoptosis (Review)[J]. Int J Oncol, 2021, 59(3): 68. |
22 | YAMAMOTO S, KAIMORI J Y, YOSHIMURA T, et al. Analysis of an ADTKD family with a novel frameshift mutation in MUC1 reveals characteristic features of mutant MUC1 protein[J]. Nephrol Dial Transplant, 2017, 32(12): 2010-2017. |
23 | WENZEL A, ALTMUELLER J, EKICI A B, et al. Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations[J]. Sci Rep, 2018, 8(1): 4170. |
24 | LI Q F, CHU Y K, LI S Z, et al. The oncoprotein MUC1 facilitates breast cancer progression by promoting Pink1-dependent mitophagy via ATAD3A destabilization[J]. Cell Death Dis, 2022, 13(10): 899. |
25 | JIN W, LIAO X D, LV Y P, et al. MUC1 induces acquired chemoresistance by upregulating ABCB1 in EGFR-dependent manner[J]. Cell Death Dis, 2017, 8(8): e2980. |
26 | RAZAWI H, KINLOUGH C L, STAUBACH S, et al. Evidence for core 2 to core 1 O-glycan remodeling during the recycling of MUC1[J]. Glycobiology, 2013, 23(8): 935-945. |
27 | KINLOUGH C L, MCMAHAN R J, POLAND P A, et al. Recycling of MUC1 is dependent on its palmitoylation[J]. J Biol Chem, 2006, 281(17): 12112-12122. |
28 | PASTRELLO C, SANTAROSA M, FORNASARIG M, et al. MUC gene abnormalities in sporadic and hereditary mucinous colon cancers with microsatellite instability[J]. Dis Markers, 2005, 21(3): 121-126. |
29 | ZHANG L X, VLAD A, MILCAREK C, et al. Human mucin MUC1 RNA undergoes different types of alternative splicing resulting in multiple isoforms[J]. Cancer Immunol Immunother, 2013, 62(3): 423-435. |
30 | STRATTON M R, CAMPBELL P J, FUTREAL P A. The cancer genome[J]. Nature, 2009, 458(7239): 719-724. |
31 | MARTÍNEZ-JIMÉNEZ F, MUIÑOS F, SENTÍS I, et al. A compendium of mutational cancer driver genes[J]. Nat Rev Cancer, 2020, 20(10): 555-572. |
32 | NABAVINIA M S, GHOLOOBI A, CHARBGOO F, et al. Anti-MUC1 aptamer: a potential opportunity for cancer treatment[J]. Med Res Rev, 2017, 37(6): 1518-1539. |
33 | HOU Y, GAO J, XU H, et al. PPARγ E3 ubiquitin ligase regulates MUC1-C oncoprotein stability[J]. Oncogene, 2014, 33(49): 5619-5625. |
34 | LIAO C H, YU L P, PANG Z, et al. WWP1 targeting MUC1 for ubiquitin-mediated lysosomal degradation to suppress carcinogenesis[J]. Signal Transduct Target Ther, 2021, 6(1): 297. |
35 | ZHANG W B, LIU M W, YU L L, et al. Perturbation effect of single polar group substitution on the self-association of amphiphilic peptide helices[J]. J Colloid Interface Sci, 2022, 610: 1005-1014. |
36 | ZHANG W B, LIU M W, WANG Y, et al. β-sheet assembly translates conservative single-site mutation into a perturbation in macroscopic structure[J]. Nano Lett, 2023, 23(6): 2370-2378. |
37 | MACAO B, JOHANSSON D G, HANSSON G C, et al. Autoproteolysis coupled to protein folding in the SEA domain of the membrane-bound MUC1 mucin[J]. Nat Struct Mol Biol, 2006, 13(1): 71-76. |
38 | MERLIN J, STECHLY L, DE BEAUCÉ S, et al. Galectin-3 regulates MUC1 and EGFR cellular distribution and EGFR downstream pathways in pancreatic cancer cells[J]. Oncogene, 2011, 30(22): 2514-2525. |
[1] | SHI Lingling, CHENG Yanyong, ZHANG Lei. Effects of sevoflurane exposure on proliferation and differentiation of primary oligodendrocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1115-1123. |
[2] | QIAN Liheng, WEN Kailing, LIAO Yingna, LI Shuxin, NIE Huizhen. Study on the effect and mechanism of sorting nexin 1 on inhibiting the proliferation and migration of colorectal cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1124-1135. |
[3] | MA Meili, TENG Jiajun, GAO Zhiqiang, SHI Chunlei, ZHONG Hua, HAN Baohui. Clinical and imaging analyses of primary mediastinal yolk sac tumor [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1155-1161. |
[4] | HU Fei, CAI Xiaohan, CHENG Rui, JI Shiyu, MIAO Jiaxin, ZHU Yan, FAN Guangjian. Progress in translational research on immunotherapy for osteosarcoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 814-821. |
[5] | ZHANG Yesheng, YANG Yijing, HUANG Yiwen, SHI Longyu, WANG Manyuan, CHEN Sisi. Research progress in immune cells regulating drug resistance of tumor cells in tumor microenvironment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 830-838. |
[6] | TAN Lu, SHEN Shaoming, HE Ping. Function and mechanism study of hypoxia-induced long non-coding RNA 68 in hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(6): 702-712. |
[7] | LI Ping, JIANG Huiru, YE Mengyue, WANG Yayu, CHEN Xiaoyu, YUAN Ancai, XU Wenjie, DAI Huimin, CHEN Xi, YAN Xiaoxiang, TU Shengxian, ZHENG Yuanqi, ZHANG Wei, PU Jun. Analysis of epidemiological characteristics of risk factors for cardiovascular diseases and malignant tumors based on the Shanghai community elderly cohort [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(5): 617-625. |
[8] | CAI Renjie, XU Ming. KHSRP regulates the responsiveness of prostate cancer cells to androgens through ANK3 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 417-426. |
[9] | AN Junyi, CHEN Biying, CHEN Xunrui, YIN Shanshan, BIAN Zhouliang, LIU Feng. SFXN3 expression in head and neck squamous cell carcinoma and its effect on cell proliferation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 427-434. |
[10] | WANG Mengting, CHEN Yinan, XUANYUAN Xinyang, YUAN Haihua. Construction and experimental validation of mouse PDX model by malignant pleural effusion-derived tumor cells from lung cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 435-443. |
[11] | LIU Linnan, FENG Li, WANG Long, LIU Jiayin, FAN Zhisong. Research progress in the expression of versican in malignant tumors and its biological roles [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 525-530. |
[12] | LI Huxiao, LI Xiaotian, ZHAO Xuri, ZHANG Huanyu, ZHOU Wei, SONG Zhongchen. Effects of gingipain extract on the biological characteristics of oral squamous cell carcinoma cell HN6 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 161-168. |
[13] | LUO Lange, ZHENG Chao, LEI Ming. Promotive effect of cancer-testis antigen CT57 on proliferation, invasion, migration and epithelial-mesenchymal transition of liver cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1335-1346. |
[14] | KONG Ruxin, ZHOU Yaqun, WEI Tingyi, LEI Ming. Function and mechanism of cancer-testis antigen CT63 in chronic myeloid leukemia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1347-1358. |
[15] | LI Yu, JIANG Yifan, TONG Rongliang, CHEN Diyu, WU Jian. Research progress in the relationship between FOXM1 and neoplasm metabolism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(10): 1323-1329. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||