Expression of long noncoding RNA LINC00467 and its mechanism in affecting lung adenocarcinoma progression

doi:10.3969/j.issn.1674-8115.2025.11.001

Abstract

Abstract:

Objective ·To investigate the expression of long noncoding RNA (lncRNA) LINC00467 in lung adenocarcinoma (LUAD) and its impact on the poor prognosis of patients, as well as its functional role and underlying molecular mechanisms in the occurrence and development of LUAD. Methods ·First, tumor sample data from The Cancer Genome Atlas (TCGA) database were utilized to analyze the expression levels of LINC00467 in LUAD tissues and its correlation with patient survival. Second, a stable LINC00467-knockdown LUAD cell line was established, and the effects of LINC00467 on LUAD cell proliferation, colony formation, migration, and tumorigenicity were assessed through cell phenotypic experiments (including live-cell imaging for cell proliferation analysis, plate colony formation assays, and wound healing assays) and nude mouse tumor formation experiments. Furthermore, RNA sequencing (RNA-seq), differentially expressed genes (DEGs) analysis, and hallmark gene sets enrichment analysis were performed to identify signaling pathways regulated by LINC00467, and Western blotting was used to validate its impact on tumor cell pathways. Finally, RNA pull-down combined with mass spectrometry and co-immunoprecipitation (co-IP) assays were conducted to filter and identify LINC00467-interacting proteins. Results ·Analysis of tumor sample data from the TCGA database showed that LINC00467 was highly expressed in LUAD, and its expression level was negatively correlated with overall survival in LUAD patients (P=0.004). Cell phenotypic experiments and nude mouse tumor formation experiments demonstrated that LINC00467 knockdown significantly inhibited the proliferation, colony formation, migration and in vivo tumorigenesis of LUAD cells (all P<0.05). RNA-seq, DEGs analysis, hallmark gene sets enrichment analysis, and Western blotting indicated that knockdown of LINC00467 suppressed the activation of nuclear factor kappa-B (NF-κB) signaling pathway. RNA pull-down combined with mass spectrometry and co-IP assays demonstrated that LINC00467 interacted with casein kinase 2 alpha 2 (CSNK2A2) and promoted the phosphorylation of NF-κB p65. Conclusion ·High expression of LINC00467 in LUAD tissues is negatively correlated with patient prognosis. LINC00467 can interact with CSNK2A2, promote the phosphorylation of NF-κB p65, activate the NF-κB pathway, and enhance LUAD proliferation, colony formation, migration, and in vivo tumorigenesis.

Key words: long noncoding RNA (lncRNA), LINC00467, lung adenocarcinoma (LUAD), nuclear factor kappa-B (NF-κB), casein kinase 2 alpha 2 (CSNK2A2)

CLC Number:

R734.2

GUO Linyan, ZHANG Hailong, ZHENG Chao, LEI Ming. Expression of long noncoding RNA LINC00467 and its mechanism in affecting lung adenocarcinoma progression[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(11): 1407-1420.

Figures/Tables 8

Tab 1 Primer sequence for qPCR

Primer	Forward (5′→3′)	Reverse (5′→3′)
LINC00467	TCGTCTTCAGGAAGCCAGAC	TGGAAATCAAAAGGGTCAGC
GAPDH	GGTCTCCTCTGACTTCAACA	GTGAGGGTCTCTCTCTTCCT

Fig 1 Schematic diagram of the RNA pull-down

Fig 2 Expression of LINC00467 in pan-cancer and its correlation analysis with OS in LUAD patients

Fig 3 Expression of LINC00467 in LUAD cells and validation of its knockdown cell lines

Fig 4 Effects of LINC00467 knockdown on the phenotype of LUAD cells

Fig 5 Effect of LINC00467 knockdown on subcutaneous tumor formation in nude mice

Fig 6 Effect of LINC00467 knockdown on NF-κB signaling pathway

Fig 7 Analysis of LINC00467-interacting proteins and its relationship with the NF-κB pathway

TrendMD

References 24

[1]	SIEGEL R L, GIAQUINTO A N, JEMAL A. Cancer statistics, 2024[J]. CA Cancer J Clin, 2024, 74(1): 12-49.
[2]	BRAY F, LAVERSANNE M, SUNG H, et al. Global cancer statistics 2022: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2024, 74(3): 229-263.
[3]	NICHOLSON A G, TSAO M S, BEASLEY M B, et al. The 2021 WHO classification of lung tumors: impact of advances since 2015[J]. J Thorac Oncol, 2022, 17(3): 362-387.
[4]	HIRSCH F R, SCAGLIOTTI G V, MULSHINE J L, et al. Lung cancer: current therapies and new targeted treatments[J]. Lancet, 2017, 389(10066): 299-311.
[5]	ENCODE Project Consortium, BIRNEY E, STAMATOYANNOPOULOS J A, et al. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project[J]. Nature, 2007, 447(7146): 799-816.
[6]	DJEBALI S, DAVIS C A, MERKEL A, et al. Landscape of transcription in human cells[J]. Nature, 2012, 489(7414): 101-108.
[7]	SUN M, KRAUS W L. From discovery to function: the expanding roles of long noncoding RNAs in physiology and disease[J]. Endocr Rev, 2015, 36(1): 25-64.
[8]	ATMADIBRATA B, LIU P Y, SOKOLOWSKI N, et al. The novel long noncoding RNA linc00467 promotes cell survival but is down-regulated by N-Myc[J]. PLoS One, 2014, 9(2): e88112.
[9]	LU J, WU X F, WANG L J, et al. Long noncoding RNA LINC00467 facilitates the progression of acute myeloid leukemia by targeting the miR-339/SKI pathway[J]. Leuk Lymphoma, 2021, 62(2): 428-437.
[10]	LI G C, XIN L, WANG Y S, et al. Long intervening noncoding 00467 RNA contributes to tumorigenesis by acting as a competing endogenous RNA against miR-107 in cervical cancer cells[J]. Am J Pathol, 2019, 189(11): 2293-2310.
[11]	DING H, LUO Y C, HU K, et al. Linc00467 promotes lung adenocarcinoma proliferation via sponging miR-20b-5p to activate CCND1 expression[J]. Onco Targets Ther, 2019, 12: 6733-6743.
[12]	LI W, HE Y F, CHEN W, et al. Knockdown of LINC00467 contributed to Axitinib sensitivity in hepatocellular carcinoma through miR-509-3p/PDGFRA axis[J]. Gene Ther, 2021, 28(10/11): 634-645.
[13]	JIANG W J, CHENG X L, WANG T, et al. LINC00467 promotes cell proliferation and metastasis by binding with IGF2BP3 to enhance the mRNA stability of TRAF5 in hepatocellular carcinoma[J]. J Gene Med, 2020, 22(3): e3134.
[14]	HE X Y, LI S, YU B B, et al. Up-regulation of LINC00467 promotes the tumourigenesis in colorectal cancer[J]. J Cancer, 2019, 10(25): 6405-6413.
[15]	GE Q W, JIA D, CEN D, et al. Micropeptide ASAP encoded by LINC00467 promotes colorectal cancer progression by directly modulating ATP synthase activity[J]. J Clin Invest, 2021, 131(22): e152911.
[16]	HOESEL B, SCHMID J A. The complexity of NF-κB signaling in inflammation and cancer[J]. Mol Cancer, 2013, 12: 86.
[17]	IIOKA H, LOISELLE D, HAYSTEAD T A, et al. Efficient detection of RNA-protein interactions using tethered RNAs[J]. Nucleic Acids Res, 2011, 39(8): e53.
[18]	MA H Z, WANG J, SHI J, et al. LncRNA LINC00467 contributes to osteosarcoma growth and metastasis through regulating HMGA1 by directly targeting miR-217[J]. Eur Rev Med Pharmacol Sci, 2020, 24(11): 5933-5945.
[19]	GLAVIANO A, FOO A S C, LAM H Y, et al. PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer[J]. Mol Cancer, 2023, 22(1): 138.
[20]	YU H, LIN L B, ZHANG Z Q, et al. Targeting NF-κB pathway for the therapy of diseases: mechanism and clinical study[J]. Signal Transduct Target Ther, 2020, 5(1): 209.
[21]	WANG D, BALDWIN A S Jr. Activation of nuclear factor-κB-dependent transcription by tumor necrosis factor-α is mediated through phosphorylation of RelA/p65 on serine 529[J]. J Biol Chem, 1998, 273(45): 29411-29416.
[22]	WANG D, WESTERHEIDE S D, HANSON J L, et al. Tumor necrosis factor α-induced phosphorylation of RelA/p65 on Ser529 is controlled by casein kinase Ⅱ[J]. J Biol Chem, 2000, 275(42): 32592-32597.
[23]	CHANG Y, YANG L. LINC00467 promotes cell proliferation and stemness in lung adenocarcinoma by sponging miR-4779 and miR-7978[J]. J Cell Biochem, 2020, 121(8/9): 3691-3699.
[24]	VIATOUR P, MERVILLE M P, BOURS V, et al. Phosphorylation of NF-κB and IκB proteins: implications in cancer and inflammation[J]. Trends Biochem Sci, 2005, 30(1): 43-52.