Anti-inflammatory and antioxidant effects of tannic acid-based ROS-responsive hydrogel in macrophage inflammation

doi:10.3969/j.issn.1674-8115.2026.07.007

Abstract

Abstract:

Objective ·To develop a reactive oxygen species (ROS)-responsive hydrogel based on tannic acid (TA), and to evaluate its anti-inflammatory and antioxidant effects in an lipopolysaccharide (LPS)-induced RAW264.7 macrophage inflammation model. Methods ·Phenylboronic acid-modified hyaluronic acid (HP) was complexed with TA to form the HP-TA hydrogel, and its ROS-responsive properties were assessed by using a hydrogen peroxide consumption assay. The biocompatibility of HP and TA in RAW264.7 macrophages was evaluated by cell counting kit-8 (CCK-8) assay, cell cycle assay, and live/dead staining. An LPS-induced inflammation model of RAW264.7 macrophages was established and treated with the HP-TA hydrogel. The mRNA and protein expression levels of pro-inflammatory genes, including inducible nitric oxide synthase (Inos) and tumor necrosis factor-α (Tnf-α), as well as antioxidant genes, including NAD(P)H: quinone oxidoreductase 1 (Nqo1) and heme oxygenase-1 (Ho-1), were analyzed by quantitative real-time PCR (qPCR) and Western blotting, respectively. A 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) fluorescent probe combined with flow cytometry and nitric oxide content detection was performed to analyze the total ROS-scavenging capacity of the hydrogel. Results ·The HP-TA hydrogel was successfully synthesized and confirmed to be ROS-responsive. At safe concentrations (200 μg/mL for HP and 25 μg/mL for TA), both materials exhibited good biocompatibility with RAW264.7 macrophages. The HP-TA hydrogel significantly inhibited the mRNA and protein expression of the pro-inflammatory genes Inos and Tnf-α, and promoted the mRNA and protein expression of the antioxidant genes Nqo1 and Ho-1 in inflammatory macrophages (all P<0.05). In addition, the HP-TA hydrogel significantly reduced the total intracellular ROS level (P<0.001). Conclusion ·The HP-TA hydrogel can effectively suppress LPS-induced inflammatory responses in macrophages, exert antioxidant effects by scavenging ROS, and upregulate the expression of antioxidant pathway proteins. This study reveals the potential of the HP-TA hydrogel as a ROS-responsive intelligent drug delivery system.

Key words: tannic acid (TA), reactive oxygen species responsiveness, lipopolysaccharide (LPS), RAW264.7, anti-inflammatory effect

CLC Number:

R392.12

Wu Jialong, Chen Xuzhuo, Huang Enkui, Yin Xiuyuan, Xu Qianhe, Liu Peinian, Zhang Shanyong. Anti-inflammatory and antioxidant effects of tannic acid-based ROS-responsive hydrogel in macrophage inflammation[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(7): 886-895.

Figures/Tables 9

Tab 1 Primer sequences for qPCR

Gene	Forward sequence (5′→3′)	Reverse sequence (5′→3′)
β-actin	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT
Inos	ACTCAGCCAAGCCCTCACCTAC	TCCAATCTCTGCCTATCCGTCTCG
Tnf-α	GCCTCTTCTCATTCCTGCTTGTGG	GTGGTTTGTGAGTGTGAGGGTCT
Ho-1	GAGCAGAACCAGCCTGAACT	AAATCCTGGGGCATGCTGTC
Nqo1	GGTAGCGGCTCCATGTACTC	CGCAGGATGCCACTCTGAAT

Fig 1 1H-NMR characterization of HP polymer

Fig 2 Microstructure of HP-TA hydrogel observed by SEM (×1 200)

Fig 3 H2O2 consumption assay of HP-TA hydrogel

Fig 4 Effects of HP and TA on the proliferation activity and cell cycle distribution of RAW264.7 macrophages

Fig 5 Calcein-AM/PI staining of RAW264.7 macrophages treated with HP and TA at safe concentrations (×200)

Fig 6 Effects of HP-TA hydrogel on the mRNA expression of pro-inflammatory and antioxidant genes in LPS-induced inflammatory RAW264.7 macrophages

Fig 7 Effects of HP-TA hydrogel on the protein expression of pro-inflammatory and antioxidant genes in LPS-induced inflammatory RAW264.7 macrophages

Fig 8 Effects of HP-TA hydrogel on the ROS expression and NO secretion levels in the LPS-induced inflammatory model of RAW264.7 macrophages

TrendMD

References 27

[1]	Bashir S, Sharma Y, Elahi A, et al. Macrophage polarization: the link between inflammation and related diseases[J]. Inflamm Res, 2016, 65(1): 1-11.
[2]	Yuan Z M, Jiang D C, Yang M Z, et al. Emerging roles of macrophage polarization in osteoarthritis: mechanisms and therapeutic strategies[J]. Orthop Surg, 2024, 16(3): 532-550.
[3]	Yang S, Zhao M, Jia S J. Macrophage: key player in the pathogenesis of autoimmune diseases[J]. Front Immunol, 2023, 14: 1080310.
[4]	Louiselle A E, Niemiec S M, Zgheib C, et al. Macrophage polarization and diabetic wound healing[J]. Transl Res, 2021, 236: 109-116.
[5]	Shapouri-Moghaddam A, Mohammadian S, Vazini H, et al. Macrophage plasticity, polarization, and function in health and disease[J]. J Cell Physiol, 2018, 233(9): 6425-6440.
[6]	Morgan M J, Liu Z G. Crosstalk of reactive oxygen species and NF-κB signaling[J]. Cell Res, 2011, 21(1): 103-115.
[7]	Chen A Q, Huang H F, Fang S M, et al. ROS: a “booster” for chronic inflammation and tumor metastasis[J]. Biochim Biophys Acta Rev Cancer, 2024, 1879(6): 189175.
[8]	Liu X Y, Song H H, Sun T R, et al. Responsive microneedles as a new platform for precision immunotherapy[J]. Pharmaceutics, 2023, 15(5): 1407.
[9]	Yu H Y, Gao R Y, Liu Y X, et al. Stimulus-responsive hydrogels as drug delivery systems for inflammation targeted therapy[J]. Adv Sci (Weinh), 2024, 11(1): e2306152.
[10]	Yan Y F, Ding H W. pH-responsive nanoparticles for cancer immunotherapy: a brief review[J]. Nanomaterials (Basel), 2020, 10(8): 1613.
[11]	Filho D, Guerrero M, Pariguana M, et al. Hydrogel-based microneedle as a drug delivery system[J]. Pharmaceutics, 2023, 15(10): 2444.
[12]	Jamaledin R, Yiu C K Y, Zare E N, et al. Advances in antimicrobial microneedle patches for combating infections[J]. Adv Mater, 2020, 32(33): e2002129.
[13]	Cao Z Y, Li D D, Wang J X, et al. Reactive oxygen species-sensitive polymeric nanocarriers for synergistic cancer therapy[J]. Acta Biomater, 2021, 130: 17-31.
[14]	Qi Z Z, Yan Z, Tan G, et al. Smart responsive microneedles for controlled drug delivery[J]. Molecules, 2023, 28(21): 7411.
[15]	Wang H, Wang C P, Zou Y, et al. Natural polyphenols in drug delivery systems: current status and future challenges[J]. Giant, 2020, 3: 100022.
[16]	Xu R Q, Ma L, Chen T, et al. Sophorolipid suppresses LPS-induced inflammation in RAW264.7 cells through the NF-κB signaling pathway[J]. Molecules, 2022, 27(15): 5037.
[17]	Liu Y, Shi Y Y, Zhang M Q, et al. Natural polyphenols for drug delivery and tissue engineering construction: a review[J]. Eur J Med Chem, 2024, 266: 116141.
[18]	Wang J, Chen X L, Chen Y, et al. Pharmacological effects and mechanisms of tannic acid[J]. Biomed Pharmacother, 2022, 154: 113561.
[19]	Qiu P P, Ouyang Y L, Liu S, et al. Environmental response temporal release injectable hydrogel for controlled growth factor release to enhance inflammatory periodontal bone defect regeneration[J]. Adv Mater, 2026, 38(3): e12531.
[20]	Ross D, Siegel D. The diverse functionality of NQO1 and its roles in redox control[J]. Redox Biol, 2021, 41: 101950.
[21]	Naito Y, Takagi T, Higashimura Y. Heme oxygenase-1 and anti-inflammatory M2 macrophages[J]. Arch Biochem Biophys, 2014, 564: 83-88.
[22]	Li M Y, Liu P P, Xue Y C, et al. Tannic acid attenuates hepatic oxidative stress, apoptosis and inflammation by activating the Keap1-Nrf2/ARE signaling pathway in arsenic trioxide-toxicated rats[J]. Oncol Rep, 2020, 44(5): 2306-2316.
[23]	Sehati F, Ahmadi I, Farivar N, et al. Tannic acid protects aged brain against cerebral hypoperfusion via modulation of Nrf2 and inflammatory pathways[J]. Neurosci Lett, 2021, 765: 136263.
[24]	Bi D H, Qu F, Xiao W Y, et al. Reactive oxygen species-responsive gel-based microneedle patches for prolonged and intelligent psoriasis management[J]. ACS Nano, 2023, 17(5): 4346-4357.
[25]	Ji M, Zhan F B, Qiu X G, et al. Research progress of hydrogel microneedles in wound management[J]. ACS Biomater Sci Eng, 2024, 10(8): 4771-4790.
[26]	Gan X, Wang X H, Huang Y W, et al. Applications of hydrogels in osteoarthritis treatment[J]. Biomedicines, 2024, 12(4): 923.
[27]	Cheng X J, Li M Y, Wang H, et al. All-small-molecule dynamic covalent gels with antibacterial activity by boronate-tannic acid gelation[J]. Chin Chem Lett, 2020, 31(3): 869-874.