SMAD7 expression in multiple myeloma and its effect on cell proliferation and drug resistance

doi:10.3969/j.issn.1674-8115.2022.07.003

Abstract

Abstract: Objective

·To analyze the expression of Sma- and Mad-related protein 7 (SMAD7) in multiple myeloma (MM), and its effect on the proliferation and drug resistance of MM cells.

Methods

·Three datasets from the Gene Expression Omnibus (GEO) database were obtained to analyze the differential expression of SMAD7 in healthy donors and MM. Bone marrow samples from 8 healthy donors and 20 MM patients were collected. The relative expression of SMAD7 mRNA in bone marrow CD138⁺ cells was detected by quantitative real-time PCR (qPCR), and the relationship between SMAD7 mRNA expression and clinical information of patients was analyzed. After overexpression of SMAD7 in MM cells KMS11, the effects of SMAD7 on the proliferation was observed by CCK8 assay and cell cycle assay. KMS11 cells overexpressing SMAD7 were treated with different concentrations of bortezomib, and the effect of SMAD7 on drug resistance and apoptosis of MM cells were observed.

Results

·The analysis of SMAD7 expression data in the datasets showed that compared with healthy donors, SMAD7 expression in MM patients was higher (all P<0.05). The results of qPCR showed that the relative expression of SMAD7 mRNAwas up-regulated in MM patients (P=0.002), although no correlation with clinical information of patients was shown. Compared with the control cells, the cell viability of KMS11 was higher after overexpression of SMAD7 (all P<0.05); the change of cell cycle distribution showed that the proportion of cells in S phase decreased (P=0.016), and the proportion of cells in G₂/M phase increased (P=0.005); after bortezomib treatment, the drug sensitivity and apoptosis level of overexpression SMAD7 cells was lower.

Conclusion

·The expression of SMAD7 is up-regulated in MM. Overexpression of SMAD7 can promote the proliferation and drug resistance of MM cells.

Key words: Sma- and Mad-related protein 7 (SMAD7), multiple myeloma (MM), cell proliferation, bortezomib

CLC Number:

R733.3

DING He, CAO Yanglin, HE Yang, WEI Xing, YANG Jianfeng. SMAD7 expression in multiple myeloma and its effect on cell proliferation and drug resistance[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 858-865.

Figures/Tables 6

TrendMD

References 20

1	KUMAR S K, RAJKUMAR V, KYLE R A, et al. Multiple myeloma[J]. Nat Rev Dis Primers, 2017, 3: 17046.
2	MINNIE S A, HILL G R. Immunotherapy of multiple myeloma[J]. J Clin Invest, 2020, 130(4): 1565-1575.
3	ROBAK P, DROZDZ I, SZEMRAJ J, et al. Drug resistance in multiple myeloma[J]. Cancer Treat Rev, 2018, 70: 199-208.
4	MIKKILINENI L, KOCHENDERFER J N. CAR T cell therapies for patients with multiple myeloma[J]. Nat Rev Clin Oncol, 2021, 18(2): 71-84.
5	SHAH U A, MAILANKODY S. Emerging immunotherapies in multiple myeloma[J]. BMJ, 2020, 370: m3176.
6	TORIMOTO Y, SHINDO M, IKUTA K, et al. Current therapeutic strategies for multiple myeloma[J]. Int J Clin Oncol, 2015, 20(3): 423-430.
7	ZHU M, ZHANG N, HE S X, et al. Exosomal miR-106a derived from gastric cancer promotes peritoneal metastasis via direct regulation of Smad7[J]. Cell Cycle, 2020, 19(10): 1200-1221.
8	LIU X, LEE J, COOLEY M, et al. Smad7 but not Smad6 cooperates with oncogenic ras to cause malignant conversion in a mouse model for squamous cell carcinoma[J]. Cancer Res, 2003, 63(22): 7760-7768.
9	ZHANG Z K, FAN Y, XIE F, et al. Breast cancer metastasis suppressor OTUD1 deubiquitinates SMAD7[J]. Nat Commun, 2017, 8(1): 2116.
10	SEHRAWAT A, SHIOTA C, MOHAMED N, et al. SMAD7 enhances adult β-cell proliferation without significantly affecting β-cell function in mice[J]. J Biol Chem, 2020, 295(15): 4858-4869.
11	KLEEFF J, ISHIWATA T, MARUYAMA H, et al. The TGF-β signaling inhibitor Smad7 enhances tumorigenicity in pancreatic cancer[J]. Oncogene, 1999, 18(39): 5363-5372.
12	LI H, LI J, CHEN L, et al. HERC3-mediated SMAD7 ubiquitination degradation promotes autophagy-induced EMT and chemoresistance in glioblastoma[J]. Clin Cancer Res, 2019, 25(12): 3602-3616.
13	JIAO C, LI L, ZHANG P, et al. REGγ ablation impedes dedifferentiation of anaplastic thyroid carcinoma and accentuates radio-therapeutic response by regulating the Smad7-TGF-β pathway[J]. Cell Death Differ, 2020, 27(2): 497-508.
14	TONG L, SHEN S H, HUANG Q, et al. Proteasome-dependent degradation of Smad7 is critical for lung cancer metastasis[J]. Cell Death Differ, 2020, 27(6): 1795-1806.
15	ZHAO S L, SUN H C, JIANG W L, et al. miR-4775 promotes colorectal cancer invasion and metastasis via the Smad7/TGFβ-mediated epithelial to mesenchymal transition[J]. Mol Cancer, 2017, 16(1): 12.
16	BAUGHN L B, DI LIBERTO M, NIESVIZKY R, et al. CDK2 phosphorylation of Smad2 disrupts TGF-β transcriptional regulation in resistant primary bone marrow myeloma cells[J]. J Immunol, 2009, 182(4): 1810-1817.
17	YU Y, GU S C, LI W J, et al. Smad7 enables STAT3 activation and promotes pluripotency independent of TGF-β signaling[J]. Proc Natl Acad Sci USA, 2017, 114(38): 10113-10118.
18	ALAS S, BONAVIDA B. Inhibition of constitutive STAT3 activity sensitizes resistant non-Hodgkin's lymphoma and multiple myeloma to chemotherapeutic drug-mediated apoptosis[J]. Clin Cancer Res, 2003, 9(1): 316-326.
19	ZHU Y X, SHI C X, BRUINS L A, et al. Identification of lenalidomide resistance pathways in myeloma and targeted resensitization using cereblon replacement, inhibition of STAT3 or targeting of IRF4[J]. Blood Cancer J, 2019, 9(2): 19.
20	ISHIKAWA H, TSUYAMA N, LIU S Q, et al. Accelerated proliferation of myeloma cells by interleukin-6 cooperating with fibroblast growth factor receptor 3-mediated signals[J]. Oncogene, 2005, 24(41): 6328-6332.

Primer	Forward （5'→3'）	Reverse （5'→3'）
SMAD7	CCAACTGCAGACTGTCCAGA	TTCTCCTCCCAGTATGCCAC
GAPDH	GTGAAGGTCGGAGTCAACGG	GTTCTCAGCCTTGACGGTGC

Primer	Forward （5'→3'）	Reverse （5'→3'）
SMAD7	CCAACTGCAGACTGTCCAGA	TTCTCCTCCCAGTATGCCAC
GAPDH	GTGAAGGTCGGAGTCAACGG	GTTCTCAGCCTTGACGGTGC

Clinical information	Relative expression of SMAD7 mRNA	P value
Gender		0.877
Male （n=13）	3.87 （0.73， 5.64）
Female （n=7）	3.35 （2.20， 4.86）
Age		0.247
<60 years （n=10）	2.52 （0.28， 4.77）
≥60 years （n=10）	3.96 （2.14， 5.56）
Plasma cell in BM^①		0.958
<10% （n=3）	3.92 （0.95， 4.01）
≥10% （n=16）	2.97 （0.81， 5.72）
Hb level^①		0.408
≥110 g·L^-1（n=10）	3.91 （0.84， 6.16）
<110 g·L^-1（n=8）	2.97 （0.53， 3.99）
Cr level^①		0.421
≥177 μmol·L^-1（n=17）	2.01 （0.10， 3.92）
<177 μmol·L^-1（n=2）	3.35 （1.33， 5.64）
LDH level		0.305
≥245 U·L^-1（n=8）	2.52 （0.35， 4.63）
<245 U·L^-1（n=12）	3.89 （2.02， 5.72）
Destruction of bone		0.699
Yes （n=7）	3.35 （1.33， 5.64）
No （n=13）	3.87 （0.33， 4.86）

Clinical information	Relative expression of SMAD7 mRNA	P value
Gender		0.877
Male （n=13）	3.87 （0.73， 5.64）
Female （n=7）	3.35 （2.20， 4.86）
Age		0.247
<60 years （n=10）	2.52 （0.28， 4.77）
≥60 years （n=10）	3.96 （2.14， 5.56）
Plasma cell in BM^①		0.958
<10% （n=3）	3.92 （0.95， 4.01）
≥10% （n=16）	2.97 （0.81， 5.72）
Hb level^①		0.408
≥110 g·L^-1（n=10）	3.91 （0.84， 6.16）
<110 g·L^-1（n=8）	2.97 （0.53， 3.99）
Cr level^①		0.421
≥177 μmol·L^-1（n=17）	2.01 （0.10， 3.92）
<177 μmol·L^-1（n=2）	3.35 （1.33， 5.64）
LDH level		0.305
≥245 U·L^-1（n=8）	2.52 （0.35， 4.63）
<245 U·L^-1（n=12）	3.89 （2.02， 5.72）
Destruction of bone		0.699
Yes （n=7）	3.35 （1.33， 5.64）
No （n=13）	3.87 （0.33， 4.86）

[1]	HU Zhexuan, ZHANG Xin, WO Lulu, LI Jingchi, WANG Jiao, ZHOU Cixiang, ZHAO Qian. Study on the function of TRMT61A in liver cancer cell and its mechanism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 742-750.
[2]	XU Feixiang, WANG Sheng, XUE Mingming, TONG Chaoyang, CHEN Yumei. Effect of altered expression of long non-coding RNA-B230352I09 on proliferation and cycle of H9C2 cardiomyocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 578-582.
[3]	Ming CHEN, Jing ZHANG. Inhibitory effect of sanguinarine on proliferaton and invasion of gastric cancer cells by upregulating m⁶A methyltransferase 14 [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 135-141.
[4]	Yan-qi HE, Rui CHI, Meng-ping CHEN, Si CHEN, Chun-liang LIU, Yun-xia LIU, Hai-peng SUN. Function of branched-chain amino acid catabolism in lung cancer cells [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 858-864.
[5]	YAN Yu-qing, SHEN Chao-qin, CHEN Hao-yan, HONG Jie#, WANG Zhen-hua#. Expression of lnc-MTBP-5 in colorectal cancer and its effect on cell invasion [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1193-1201.
[6]	HUANG Cong-hua, GAO Ting, LU Xiao-ye, ZHU Chang-qing. A case report: κ light chain multiple myeloma with posterior reversible encephalopathy syndrome [J]. , 2019, 39(3): 336-.
[7]	SUN Bao-hangxing1, LU Yi1, WANG Yi-qing1, ZHOU Jia-le1, LIN Meng-lu1, SONG Wei2, JIANG Meng1, BU Jun1. Comparative cultivation of single cell derived placental mesenchymal stromal cells in vitro [J]. , 2018, 38(9): 1033-.
[8]	XU Hua-li, LIU Wen-xue, SHEN Fang-qian, XI Xiao-wei. Effects of UBE3C on proliferation and invasion in ovarian cancer SKOV3 cells [J]. , 2018, 38(6): 610-.
[9]	XIA Yi-ru, XIE Yu-feng, SHU Rong . Establishment of a replicative senescence model of human gingival fibroblasts [J]. , 2017, 37(5): 578-.
[10]	WAN Jian-wei, ZHOU Lin, ZHAO Dan-dan, YANG Yu-qin, LU Li-ming. Effects of PHPO on apoptosis and proliferation of lung cancer cell line A549#br# [J]. , 2017, 37(10): 1315-.
[11]	SUN Yi-feng, XU Peng-peng, ZHAO Wei-li. Expression and biological effect of long non-coding RNA ST20-AS1 in T-cell lymphoma [J]. , 2016, 36(9): 1265-.
[12]	ZHOU Yi, QIN Jian, LI Xu, ZHU Lin, LI Ji-kun. Expression of DNMT1 in gastric carcinoma tissue and its effects on proliferation and migration of gastric carcinoma cells [J]. , 2016, 36(7): 956-.
[13]	WANG Xiao-Bo, WANG Hao-Yu, YAO Jun-Ji, ZENG Wan-Qin, LIU Hai-Shan, ZHAO Ke-Wen. Study on the regulation of KLF5 expression by hypoxia-inducible factor-1α [J]. , 2016, 36(5): 619-.
[14]	Lü Yi-xuan, WANG Xiao-na*, WU Jin-liang, XU Yan, MI Jun . Effects of mitochondrial dicarboxylate carrier SLC25A10 on the proliferation of glioma cells and relevant mechanisms [J]. , 2016, 36(11): 1581-.
[15]	FAN Qing-ye， WANG Yan， MI Jian-qing. Study on the efficacy of bortezomib on CD56 negative multiple myeloma patients [J]. , 2016, 36(10): 1445-.