
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2022, Vol. 42 ›› Issue (9): 1188-1196.doi: 10.3969/j.issn.1674-8115.2022.09.005
• Innovative research team achievement column • Previous Articles Next Articles
YANG Wenqian1(
), CHEN Chiqi1(
), ZHAO Lu1, CAO Liyuan1, XIA Yiqiu1, LU Zhigang2(
), ZHENG Junke1(
)
Received:2022-06-13
Accepted:2022-08-21
Online:2022-10-20
Published:2022-09-28
Contact:
LU Zhigang,ZHENG Junke
E-mail:117710910043@sjtu.edu.cn;zhiganglu@fudan.edu.cn;zhengjunke@shsmu.edu.cn
Supported by:CLC Number:
YANG Wenqian, CHEN Chiqi, ZHAO Lu, CAO Liyuan, XIA Yiqiu, LU Zhigang, ZHENG Junke. Immune inhibitory receptor LILRB2 enhances SARS-CoV-2 spike protein-mediated immune inflammation[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1188-1196.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2022.09.005
| Gene (human) | Forward sequence (5'→3') | Reverse sequence (5'→3') |
|---|---|---|
| IL-6 | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG |
| IL-8 | ACTGAGAGTGATTGAGAGTGGAC | AACCCTCTGCACCCAGTTTTC |
| IL-2 | TCCTGTCTTGCATTGCACTAAG | CATCCTGGTGAGTTTGGGATTC |
| IL-10 | GACTTTAAGGGTTACCTGGGTTG | TCACATGCGCCTTGATGTCTG |
| IL-1β | ATGATGGCTTATTACAGTGGCAA | GTCGGAGATTCGTAGCTGGA |
| ARG-1① | TGGACAGACTAGGAATTGGCA | CCAGTCCGTCAACATCAAAACT |
| TGF-β | GGCCAGATCCTGTCCAAGC | GTGGGTTTCCACCATTAGCAC |
| actin | AGAGCTACGAGCTGCCTGAC | AGCACTGTGTTGGCGTACAG |
Tab 1 Primer sequences for qRT-PCR
| Gene (human) | Forward sequence (5'→3') | Reverse sequence (5'→3') |
|---|---|---|
| IL-6 | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG |
| IL-8 | ACTGAGAGTGATTGAGAGTGGAC | AACCCTCTGCACCCAGTTTTC |
| IL-2 | TCCTGTCTTGCATTGCACTAAG | CATCCTGGTGAGTTTGGGATTC |
| IL-10 | GACTTTAAGGGTTACCTGGGTTG | TCACATGCGCCTTGATGTCTG |
| IL-1β | ATGATGGCTTATTACAGTGGCAA | GTCGGAGATTCGTAGCTGGA |
| ARG-1① | TGGACAGACTAGGAATTGGCA | CCAGTCCGTCAACATCAAAACT |
| TGF-β | GGCCAGATCCTGTCCAAGC | GTGGGTTTCCACCATTAGCAC |
| actin | AGAGCTACGAGCTGCCTGAC | AGCACTGTGTTGGCGTACAG |
| 1 | V'KOVSKI P, KRATZEL A, STEINER S, et al. Coronavirus biology and replication: implications for SARS-CoV-2[J]. Nat Rev Microbiol, 2021, 19(3): 155-170. |
| 2 | YAO H, SONG Y, CHEN Y, et al. Molecular architecture of the SARS-CoV-2 virus[J]. Cell, 2020, 183(3): 730-738.e13. |
| 3 | WALLS A C, PARK Y J, TORTORICI M A, et al. Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein[J]. Cell, 2020, 181(2): 281-292.e6. |
| 4 | HOFFMANN M, KLEINE-WEBER H, SCHROEDER S, et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor[J]. Cell, 2020, 181(2): 271-280.e8. |
| 5 | YAN R, ZHANG Y, LI Y, et al. Structural basis for the recognition of SARS-CoV-2 by full-length human ACE2[J]. Science, 2020, 367(6485): 1444-1448. |
| 6 | BENTON D J, WROBEL A G, XU P, et al. Receptor binding and priming of the spike protein of SARS-CoV-2 for membrane fusion[J]. Nature, 2020, 588(7837): 327-330. |
| 7 | WANG Q, ZHANG Y, WU L, et al. Structural and functional basis of SARS-CoV-2 entry by using human ACE2[J]. Cell, 2020, 181(4): 894-904. e9. |
| 8 | ZANG R, GOMEZ CASTRO M F, MCCUNE B T, et al. TMPRSS2 and TMPRSS4 promote SARS-CoV-2 infection of human small intestinal enterocytes[J]. Sci Immunol, 2020, 5(47): eabc3582. |
| 9 | WANG K, CHEN W, ZHANG Z, et al. CD147-spike protein is a novel route for SARS-CoV-2 infection to host cells[J]. Signal Transduct Target Ther, 2020, 5(1): 283. |
| 10 | MORNIROLI D, GIANNÌ M L, CONSALES A, et al. Human sialome and coronavirus disease-2019 (COVID-19) pandemic: an understated correlation?[J]. Front Immunol, 2020, 11: 1480. |
| 11 | CANTUTI-CASTELVETRI L, OJHA R, PEDRO L D, et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity[J]. Science, 2020, 370(6518): 856-860. |
| 12 | YANG X, YU Y, XU J, et al. Clinical course and outcomes of critically ill patients with SARS-CoV-2 pneumonia in Wuhan, China: a single-centered, retrospective, observational study[J]. Lancet Respir Med, 2020, 8(5): 475-481. |
| 13 | XU Z, SHI L, WANG Y, et al. Pathological findings of COVID-19 associated with acute respiratory distress syndrome[J]. Lancet Respir Med, 2020, 8(4): 420-422. |
| 14 | SOY M, KESER G, ATAGÜNDÜZ P. Pathogenesis and treatment of cytokine storm in COVID-19[J]. Turk J Biol, 2021, 45(4): 372-389. |
| 15 | LI G, FAN Y, LAI Y, et al. Coronavirus infections and immune responses[J]. J Med Virol, 2020, 92(4): 424-432. |
| 16 | LU Q, LIU J, ZHAO S, et al. SARS-CoV-2 exacerbates proinflammatory responses in myeloid cells through C-type lectin receptors and Tweety family member 2[J]. Immunity, 2021, 54(6): 1304-1319.e9. |
| 17 | CHEN H M, VAN DER TOUW W, WANG Y S, et al. Blocking immunoinhibitory receptor LILRB2 reprograms tumor-associated myeloid cells and promotes antitumor immunity[J]. J Clin Invest, 2018, 128(12): 5647-5662. |
| 18 | GU Y, CAO J, ZHANG X, et al. Receptome profiling identifies KREMEN1 and ASGR1 as alternative functional receptors of SARS-CoV-2[J]. Cell Res, 2022, 32(1): 24-37. |
| 19 | BOST P, GILADI A, LIU Y, et al. Host-viral infection maps reveal signatures of severe COVID-19 patients[J]. Cell, 2020, 181(7): 1475-1488.e12. |
| 20 | TANAKA T, NARAZAKI M, KISHIMOTO T. IL-6 in inflammation, immunity, and disease[J]. Cold Spring Harb Perspect Biol, 2014, 6(10): a016295. |
| 21 | VABRET N, BRITTON G J, GRUBER C, et al. Immunology of COVID-19: current state of the science[J]. Immunity, 2020, 52(6): 910-941. |
| 22 | GONG J, DONG H, XIA Q S, et al. Correlation analysis between disease severity and inflammation-related parameters in patients with COVID-19: a retrospective study[J]. BMC Infect Dis, 2020, 20(1): 963. |
| 23 | EVEREST H, STEVENSON-LEGGETT P, BAILEY D, et al. Known cellular and receptor interactions of animal and human coronaviruses: a review[J]. Viruses, 2022, 14(2): 351. |
| 24 | WANG W, TANG J, WEI F. Updated understanding of the outbreak of 2019 novel coronavirus (2019-nCoV) in Wuhan, China[J]. J Med Virol, 2020, 92(4): 441-447. |
| 25 | COSTELA-RUIZ V J, ILLESCAS-MONTES R, PUERTA-PUERTA J M, et al. SARS-CoV-2 infection: the role of cytokines in COVID-19 disease[J]. Cytokine Growth Factor Rev, 2020, 54: 62-75. |
| 26 | GUBERNATOROVA E O, GORSHKOVA E A, POLINOVA A I, et al. IL-6: relevance for immunopathology of SARS-CoV-2[J]. Cytokine Growth Factor Rev, 2020, 53: 13-24. |
| 27 | POTERE N, BATTICCIOTTO A, VECCHIÉ A, et al. The role of IL-6 and IL-6 blockade in COVID-19[J]. Expert Rev Clin Immunol, 2021, 17(6): 601-618. |
| 28 | DERAKHSHANI A, HEMMAT N, ASADZADEH Z, et al. Arginase 1 (Arg1) as an up-regulated gene in COVID-19 patients: a promising marker in COVID-19 immunopathy[J]. J Clin Med, 2021, 10(5): 1051. |
| 29 | ZUO J, DOWELL A C, PEARCE H, et al. Robust SARS-CoV-2-specific T cell immunity is maintained at 6 months following primary infection[J]. Nat Immunol, 2021, 22(5): 620-626. |
| 30 | JONES S A, HUNTER C A. Is IL-6 a key cytokine target for therapy in COVID-19?[J]. Nat Rev Immunol, 2021, 21(6): 337-339. |
| 31 | FERREIRA-GOMES M, KRUGLOV A, DUREK P, et al. SARS-CoV-2 in severe COVID-19 induces a TGF-β-dominated chronic immune response that does not target itself[J]. Nat Commun, 2021, 12(1): 1961. |
| 32 | KUDO T, HAYASHI Y, KUNIEDA K, et al. Persistent intrathecal interleukin-8 production in a patient with SARS-CoV-2-related encephalopathy presenting aphasia: a case report[J]. BMC Neurol, 2021, 21(1): 426. |
| 33 | HAN H, MA Q F, LI C, et al. Profiling serum cytokines in COVID-19 patients reveals IL-6 and IL-10 are disease severity predictors[J]. Emerg Microbes Infect, 2020, 9(1): 1123-1130. |
| 34 | TRIPATHY A S, VISHWAKARMA S, TRIMBAKE D, et al. Pro-inflammatory CXCL-10, TNF-α, IL-1β, and IL-6: biomarkers of SARS-CoV-2 infection[J]. Arch Virol, 2021, 166(12): 3301-3310. |
| 35 | GIAMARELLOS-BOURBOULIS E J, NETEA M G, ROVINA N, et al. Complex immune dysregulation in COVID-19 patients with severe respiratory failure[J]. Cell Host Microbe, 2020, 27(6): 992-1000.e3. |
| 36 | MOORE J B, JUNE C H. Cytokine release syndrome in severe COVID-19[J]. Science, 2020, 368(6490): 473-474. |
| 37 | LUO P, LIU Y, QIU L, et al. Tocilizumab treatment in COVID-19: a single center experience[J]. J Med Virol, 2020, 92(7): 814-818. |
| 38 | GAUTRET P, LAGIER J C, PAROLA P, et al. Hydroxychloroquine and azithromycin as a treatment of COVID-19: results of an open-label non-randomized clinical trial[J]. Int J Antimicrob Agents, 2020, 56(1): 105949. |
| 39 | WU D, YANG X O. TH17 responses in cytokine storm of COVID-19: an emerging target of JAK2 inhibitor fedratinib[J]. J Microbiol Immunol Infect, 2020, 53(3): 368-370. |
| [1] | WANG Guijie, DU Chuanchong, LU Ye, ZHAO Jian, SHEN Xie, JIN Donglin, GENG Jiacai. Changes of serum high mobility group box 1 and soluble triggering receptor expressed on myeloid cells-1 in patients with multiple injuries and their prognostic significance [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(3): 350-357. |
| [2] | LI Bo, HU Qiuxia, WU Ximei, SHE Ruonan, TAN Jinhui, LUO Junjia, YANG Haitao, ZHANG Haoru. Expression of miR-146a in CD4+ T lymphocytes of patients with rheumatoid arthritis and its correlation with inflammatory cytokines [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(10): 1249-1254. |
| [3] | YIN Zi, LIAN Chaoyang, GAO Bo, TIAN Ying, HAO Qian, YEAP Lengsiew. Enhancement of the neutralization ability resulting from a single amino acid change in the light chain of a chimeric antibody against SARS-CoV-2 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 718-727. |
| [4] | JIANG Gan, YANG Yuquan, CHEN Yaoxing, HOU Zhaoyuan, GAO Xiaoling, CHEN Hongzhuan, JIA Hao. Preliminary study on the cellular level of SARS-CoV-2 proteins mediated by macropinocytosis pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 987-996. |
| [5] | Xiaowen ZHANG, Yi WANG, Chan ZHANG, Di ZHANG, Hang YUN, Di HUANG. Effects of Pcsk9 gene interference on high fat-induced nonalcoholic fatty liver disease with atherosclerosis in rats [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 150-157. |
| [6] | Rui CHEN, Yun ZHAO, Xiao-xia ZHAO, Dong MA, Yi-jiang HAN, Deng-ming LAI, Wei-zhong GU, Jin-fa TOU. Expression characteristics of silent information regulator transcript 1 in intestinal tissues of neonatal necrotizing enterocolitis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(9): 1154-1161. |
| [7] | Jia-qiang LUO, Liang-yu ZHAO, Chen-cheng YAO, Zi-jue ZHU, Xiao-yu XING, Peng LI, Ru-hui TIAN, Hui-xing CHEN, Jie SUN, Zheng LI. Single-cell RNA sequencing reveals the spatio-temporal expression profile of SARS-CoV-2 related receptor in human and mouse testes [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(4): 421-426. |
| [8] | WANG Xiao-yu, CUI Li. A source-seeking analysis and its implication on the transmission of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) [J]. , 2020, 40(2): 149-. |
| [9] | WANG Ling-xiao, LIU Ting-ting, YANG Xiao-hui, YAO Zhi-qing, CAI Hui-zhen. Effect of Lycium barbarum polysaccharides on inflammatory cytokines in type 2 diabetes mellitus model mice without myeloid differentiation factor 88 gene [J]. , 2019, 39(2): 136-. |
| [10] | ZHOU Ju-mei1, YUAN Ke-yong2, LIN Wen-zhen2, HU Xu-chen2, JIN Qiao-qiao2, NIU Chen-guang2. Influence of 3,3’-diindolylmethane on expression of inflammatory cytokines in periodontal ligament cells induced by lipopolysaccharide [J]. , 2018, 38(2): 138-. |
| [11] | LU Yang, XUE Fei, ZHAO Hong-sheng, et al. Effect of dexmedetomidine on expression of triggering receptor expressed on myeloid cells-1 in lung tissues of rats with sepsis [J]. , 2015, 35(9): 1274-. |
| [12] | HUANG Hai-yuan, PAN Xing-shou, HUANG Xian-nan, et al. Effects of atorvastatin on hypertension patients with dyslipidemia and body's inflammatory response [J]. , 2014, 34(11): 1642-. |
| [13] | SHANG Jia-wei, LIU Xi, WEI Hai-ling, et al. Activation of proinflammatory cytokines and transduction pathways in acute fat embolism syndrome mouse model [J]. , 2013, 33(2): 140-. |
| [14] | HUANG Cui-hua. Energy metabolism and related mechanism in patients with malignant tumors [J]. , 2010, 30(1): 42-. |
| [15] | WAN Yan-ping, XU Ren-ying, SHEN Wan-rong, et al. Distribution of HOMA-IR index and its relationship with metabolic syndrome and inflammatory cytokines in students aged 7 to 14 years [J]. , 2010, 30(1): 16-. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||