CTCF regulates lipid metabolism and gene expression in mouse AML12 liver cell line

doi:10.3969/j.issn.1674-8115.2024.09.002

Abstract

Abstract:

Objective ·To clarify the regulatory role of CCCTC-binding factor (CTCF) in lipid metabolism in liver cells, and explore the mechanisms by which CTCF regulates liver cell gene expression. Methods ·Immortalized AML12 liver cell line was used as a model to investigate the functions of CTCF in liver cells. To stably knock down Ctcf, DNA sequences stably expressing Ctcf shRNA were integrated into AML12 cells through lentivirus. The knockdown efficiency of Ctcf was verified by RT-qPCR and Western blotting. The effects of Ctcf knockdown on cell growth and cell cycle were assessed by performing CCK-8 assay and propidium iodide (PI) staining. Intracellular lipids, labeled with Oil Red O staining, were analyzed and quantified to detect the effect of CTCF on lipid metabolism and lipid droplet accumulation in AML12 cells. Changes in CTCF genome distribution after Ctcf knockdown were analyzed using the Cleavage Under Targets and Tagmentation (CUT&Tag) method. Transcriptome changes in AML12 cells after Ctcf knockdown were quantified by RNA sequencing (RNA-seq). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, and gene set enrichment analysis (GSEA) were employed to evaluate the functions of differentially expressed genes. The correlation between gene expression changes and CTCF binding changes was further assessed by performing statistical analyses. Results ·The result of RT-qPCR showed that Ctcf is downregulated 63.4% in mRNA level and 57.7% in protein level (both P<0.05). Assay of the growth curve and cycle phase confirmed that cell proliferation was inhibited in the G₁/G₀ phase after Ctcf knockdown. After Ctcf knockdown, AML12 cells exhibited spontaneous accumulation of intracellular lipids, indicating dysregulation of lipid metabolism (P<0.05). Genome-wide CTCF binding analysis revealed significant changes, with most differential CTCF peaks showing decreased binding, although a subset of regions exhibited increased CTCF binding. Transcriptome analyses revealed that knocking down Ctcf resulted in significant expression changes in 1 344 genes. These differentially expressed genes were enriched in lipid metabolism pathways. Further analysis showed that genes associated with regions of increased CTCF binding were enriched in pathways related to lipid transport and localization, whereas genes associated with regions of decreased CTCF binding were mainly enriched in processes such as DNA damage repair, apoptosis, and cell cycle regulation. However, the binding changes of CTCF in the genome were not sufficient to lead to the expression changes of their neighboring genes. Conclusion ·CTCF affects the metabolic function of liver cells by regulating the expression of lipid metabolism-related genes. However, the binding changes of CTCF in the genome lack significant correlation with the expression of their neighboring genes, suggesting that CTCF mainly influences liver gene expression through long-distance regulation, possibly by modulating higher-order chromatin structure and enhancer-promoter interactions.

Key words: CCCTC-binding factor (CTCF), AML12 cell line, lipid metabolism, transcription regulation

CLC Number:

R394.3

CHEN Huaihuang, ZUO Wu, BIAN Qian. CTCF regulates lipid metabolism and gene expression in mouse AML12 liver cell line[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1069-1082.

Figures/Tables 11

Tab 1 shRNA sequences

Primer name	Sequence (5′→3′)
Mouse Ctcf-shRNA 1	GGTGCAATTGAGAACATTATA CTCGAG TATAATGTTCTCAATTGCACC
Mouse Ctcf-shRNA 2	TGGACGATACCCAGATCATAACTCGAGTTATGATCTGGGTATCGTCCA
Mouse scramble shRNA	TTCTCCGAACGTGTCACGT CTCGAG ACGTGACACGTTCGGAGAA

Tab 2 Primer sequences for RT-qPCR

Gene	Forward primer (5′→3′)	Reverse primer (5′→3′)
Ctcf	AACAGTGACCCTCCTGAGGAATC	TATAACGACGATGCCGCACCA
β-actin	CATTGCTGACAGGATGCAGAAGG	TGCTGGAAGGTGGACAGTGAGG

Fig 1 Validation of Ctcf knockdown and assessment of its impact on cell proliferation

Fig 2 Genome-wide changes in CTCF binding after Ctcf knockdown

Fig 3 Analysis of genes associated with changed or unchanged CTCF peaks after Ctcf knockdown

Fig 4 Increased lipid droplet accumulation after Ctcf knockdown

Fig 5 Transcriptome changes after Ctcf knockdown

Tab 3 Classification statistics of CTCF-associated and CTCF-non-associated genes

Gene

CTCF-associated

gene

CTCF-non-associated

gene

Fig 6 Analysis of the correlation between CTCF binding changes and gene expression changes

Tab 4 Statistics of genes annotated with differential CTCF binding peaks and differentially expressed genes in AML12 cells

Gene	CTCF up peak annotation	CTCF unchanged peak annotation	CTCF down peak annotation
Downregulated gene	14	338	117
Unchange gene	294	5 323	1 803
Upregualated gene	48	461	158

Fig 7 Complex effects of CTCF binding changes on gene expression

TrendMD

References 23

1	ARZATE-MEJÍA R G, RECILLAS-TARGA F, CORCES V G. Developing in 3D: the role of CTCF in cell differentiation[J]. Development, 2018, 145(6): dev137729.
2	KUBO N, ISHII H, XIONG X, et al. Promoter-proximal CTCF binding promotes distal enhancer-dependent gene activation[J]. Nat Struct Mol Biol, 2021, 28(2): 152-161.
3	LIU Y T, WAN X, LI H, et al. CTCF coordinates cell fate specification via orchestrating regulatory hubs with pioneer transcription factors[J]. Cell Rep, 2023, 42(10): 113259.
4	BISSERIER M, MATHIYALAGAN P, ZHANG S H, et al. Regulation of the methylation and expression levels of the BMPR2 gene by SIN3a as a novel therapeutic mechanism in pulmonary arterial hypertension[J]. Circulation, 2021, 144(1): 52-73.
5	NUEBLER J, FUDENBERG G, IMAKAEV M, et al. Chromatin organization by an interplay of loop extrusion and compartmental segregation[J]. Proc Natl Acad Sci U S A, 2018, 115(29): E6697-E6706.
6	XIANG J F, CORCES V G. Regulation of 3D chromatin organization by CTCF[J]. Curr Opin Genet Dev, 2021, 67: 33-40.
7	DAVIDSON I F, BARTH R, ZACZEK M, et al. CTCF is a DNA-tension-dependent barrier to cohesin-mediated loop extrusion[J]. Nature, 2023, 616(7958): 822-827.
8	ROWLEY M J, CORCES V G. Organizational principles of 3D genome architecture[J]. Nat Rev Genet, 2018, 19(12): 789-800.
9	DEHINGIA B, MILEWSKA M, JANOWSKI M, et al. CTCF shapes chromatin structure and gene expression in health and disease[J]. EMBO Rep, 2022, 23(9): e55146.
10	HYLE J, ZHANG Y, WRIGHT S, et al. Acute depletion of CTCF directly affects MYC regulation through loss of enhancer-promoter looping[J]. Nucleic Acids Res, 2019, 47(13): 6699-6713.
11	RAHME G J, JAVED N M, PUORRO K L, et al. Modeling epigenetic lesions that cause gliomas[J]. Cell, 2023, 186(17): 3674-3685.e14.
12	POULOS R C, THOMS J A I, GUAN Y F, et al. Functional mutations form at CTCF-cohesin binding sites in melanoma due to uneven nucleotide excision repair across the motif[J]. Cell Rep, 2016, 17(11): 2865-2872.
13	RIBEIRO DE ALMEIDA C, STADHOUDERS R, DE BRUIJN M J, et al. The DNA-binding protein CTCF limits proximal Vκ recombination and restricts κ enhancer interactions to the immunoglobulin κ light chain locus[J]. Immunity, 2011, 35(4): 501-513.
14	HIRAYAMA T, TARUSAWA E, YOSHIMURA Y, et al. CTCF is required for neural development and stochastic expression of clustered Pcdh genes in neurons[J]. Cell Rep, 2012, 2(2): 345-357.
15	CHRISTOV M, CLARK A R, CORBIN B, et al. Inducible podocyte-specific deletion of CTCF drives progressive kidney disease and bone abnormalities[J]. JCI Insight, 2018, 3(4): e95091.
16	GOMEZ-VELAZQUEZ M, BADIA-CAREAGA C, LECHUGA-VIECO A V, et al. CTCF counter-regulates cardiomyocyte development and maturation programs in the embryonic heart[J]. PLoS Genet, 2017, 13(8): e1006985.
17	DUBOIS-CHEVALIER J, OGER F, DEHONDT H, et al. A dynamic CTCF chromatin binding landscape promotes DNA hydroxymethylation and transcriptional induction of adipocyte differentiation[J]. Nucleic Acids Res, 2014, 42(17): 10943-10959.
18	WANG R R, QIU X Y, PAN R, et al. Dietary intervention preserves β cell function in mice through CTCF-mediated transcriptional reprogramming[J]. J Exp Med, 2022, 219(7): e20211779.
19	CHOI Y, SONG M J, JUNG W J, et al. Liver-specific deletion of mouse CTCF leads to hepatic steatosis via augmented PPARγ signaling[J]. Cell Mol Gastroenterol Hepatol, 2021, 12(5): 1761-1787.
20	WANG W, REN G, HONG N, et al. Exploring the changing landscape of cell-to-cell variation after CTCF knockdown via single cell RNA-seq[J]. BMC Genomics, 2019, 20(1): 1015.
21	PINTO P B, DOMSCH K, LOHMANN I. Hox function and specificity: a tissue centric view[J]. Semin Cell Dev Biol, 2024, 152/153: 35-43.
22	AITKEN S J, IBARRA-SORIA X, KENTEPOZIDOU E, et al. CTCF maintains regulatory homeostasis of cancer pathways[J]. Genome Biol, 2018, 19(1): 106.
23	DAVIDSON I F, PETERS J M. Genome folding through loop extrusion by SMC complexes[J]. Nat Rev Mol Cell Biol, 2021, 22(7): 445-464.

[1]	ZHU Zijun, QIAN Yife, LI Qianyu, LI Songling, QIN Wenli, LIU Yanfeng. Anaphase-promoting complex subunit 10 promotes hepatocellular carcinoma progression through regulation of the PI3K-AKT-mTOR signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1171-1182.
[2]	WANG Renjie, HUA Hui, ZHU ChaoYu, WEI Li. Advances of GADD45b in hepatic glucose and lipid metabolism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(10): 1316-1322.
[3]	JIANG Quanxin, CHEN Suzhen, LIU Junli. Research progress in ceruloplasmin regulation of lipid metabolism homeostasis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(1): 124-130.
[4]	WANG Jie, WU Hui, LU Lingpeng, YANG Kefeng, ZHU Jie, ZHOU Hengyi, YAO Die, GAO Ya, FENG Yuting, LIU Yuhong, JIA Jie. Dynamic changes in gut microbiota of women with gestational diabetes mellitus and the correlation with blood glucose, blood lipid and diet [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1336-1346.
[5]	HU Chanchan, FAN Yi, XU Yuan, HU Zhijian, ZENG Yiming. Lipid metabolism and lung cancer: emerging roles in occurrence, progression, diagnosis and treatment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(12): 1766-1771.
[6]	Jiang YUE, Yong ZHOU, Hua XU, Wen LIU, Xiao-feng HAN, Qing MAO, Ji-dong ZHANG, Jing MA, Han-dong JIANG, Wei LIU. Characteristic analysis and comparison of glycolipid metabolism in patients with coronavirus disease 2019 in common condition and severe cases [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(3): 355-359.
[7]	Zhuo-yi YANG, Hui CHEN, Si-yi BAI, Pameila PERHATI, Jing-li HOU, Yun-sheng YUAN. Phosphoproteomic analysis of concanavalin A-induced hepatocytes injury [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(1): 1-7.
[8]	PENG Rong, YANG Li-jun, DENG Mao-lin. Effects of low-carbohydrate diet on body weight and glycolipid metabolism in normal rats and obese rats [J]. , 2020, 40(1): 44-.
[9]	YE Hua-ying1, 2, LI Hua-ping2. Correlation analysis of plasma lipid with glucose status and insulin resistance in pregnant women with gestational diabetes mellitus [J]. , 2019, 39(7): 768-.
[10]	ZHAO Ming-liang1, 2, ZHAO Ai-hua1, ZHENG Xiao-jiao1, JIA Wei1. Role of farnesol X receptor in glycolipid metabolism regulation [J]. , 2019, 39(6): 671-.
[11]	SUI Chun-hua, LU Ying-li, GUO Yu-yu. Effects of GLP-1 analogues on kidney function and kidney ultrastructure in type 2 diabetic rats [J]. , 2018, 38(1): 48-.
[12]	FENG Sui-bin, LIU Hai-jun, ZHOU Zhou, WANG Xiao, HU Cheng, ZHANG Xue-li1. Effect of Roux-en-Y gastric bypass surgery on hepatic glucolipid metabolism in rats with obesity combined with type 2 diabetes mellitus#br# [J]. , 2017, 37(9): 1201-.
[13]	MIN Xue-jie, ZHAO Li, ZHAO Xiao-ping. Research progresses of SREBP in tumors [J]. , 2016, 36(8): 1256-.
[14]	GAO Gui-rong, DONG Ying. Advanced research of liver X receptor in lipid metabolism [J]. , 2013, 33(11): 1529-.
[15]	NI Jie, BAO Yu-qian. Research progress of fibroblast growth factor 19 with glucose, lipid and protein metabolism [J]. , 2012, 32(10): 1378-.