Role of tumor necrosis factor-α in coronavirus disease 2019-associated kidney injury

doi:10.3969/j.issn.1674-8115.2025.01.001

Abstract

Abstract:

Objective ·To identify relevant biomarkers for patients with coronavirus disease 2019-associated kidney injury (COVID-19-associated KI) and explore the mechanisms underlying the involvement of severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) proteins in infection-related KI by affecting the interactions between renal cells and macrophages. Methods ·A retrospective analysis was conducted on the clinical characteristics of COVID-19 patients with KI treated in Shanghai Ninth, People′s, hospital from December 2022 to February 2023. Serum levels of inflammatory factors and chemokines were measured by using enzyme- linked immunosorbent assay (ELISA). In vitro, human macrophage cell line THP-1 cells were stimulated with recombinant S1 subunit protein derived from SARS-CoV-2 spike protein. The cells and culture supernatants were collected to detect the levels of inflammatory factors and chemokines by using quantitative real-time PCR (qRT-PCR) and ELISA. Conditioned medium was prepared from the cell culture supernatants of S1-stimulated THP-1 cells and used to stimulate human renal epithelial cells (HK-2) in vitro to assess cytokine secretion. Antibody blocking experiments were performed to analyze the effects of the conditioned medium on the production of cytokines in HK-2 cells. Results ·Among 39 patients with COVID-19, 8 (20.50%) had creatinine levels above the reference interval, which indicated the occurrence of KI. The levels of peripheral tumor necrosis factor-α (TNF-α) in the COVID-19 patient with KI group [(18.33±8.20) pg/mL] were significantly higher than those in the non-KI group [(11.88±6.50) pg/mL] (P=0.015). In vitro assay has shown that S1-spike protein stimulation promoted the level of gene transcription and production of TNF-α, interleukin-1β (IL-1β) and chemokine C-X-C motif ligand 10 (CXCL10) in THP-1 macrophage cells (P<0.001). Furthermore, the conditioned medium from S1-stimulated THP-1 cells promoted the secretion of TNF-α, IL-1β and CXCL10 by HK-2 cells (P=0.005). When anti-TNF-α antibody (Infliximab) was used to block TNF-α in the culture supernatants from S1-stimulated THP-1 cells, the secretion level of TNF-α by HK-2 cells decreased dramatically (P<0.001). Conclusion ·TNF-α levels increase significantly in COVID-19 patients with KI, implying the significance of TNF-α in the occurrence of COVID-19-associated KI. In vitro experiments confirm that the S1 protein induces TNF-α secretion from THP-1 cells, leading to increased inflammatory responses in renal cells, which may contribute to the development of COVID-19-associated KI. Therefore, targeting TNF-α may become an alternative strategy to reduce the occurrence of COVID-19-associated KI.

Key words: tumor necrosis factor-α, coronavirus disease 2019, kidney injury, inflammatory responses, therapeutic target

CLC Number:

R392.9

PANDIT Roshan, LU Junyao, HE Liheng, BAO Yujie, JI Ping, CHEN Yingying, XU Jie, WANG Ying. Role of tumor necrosis factor-α in coronavirus disease 2019-associated kidney injury[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 1-10.

Figures/Tables 8

TrendMD

References 29

1	MOKHTARI T, HASSANI F, GHAFFARI N, et al. COVID-19 and multiorgan failure: a narrative review on potential mechanisms[J]. J Mol Histol, 2020, 51(6): 613-628.
2	JEWELL P D, BRAMHAM K, GALLOWAY J, et al. COVID-19-related acute kidney injury; incidence, risk factors and outcomes in a large UK cohort[J]. BMC Nephrol, 2021, 22(1): 359.
3	SCHIFFL H, LANG S M. Long-term interplay between COVID-19 and chronic kidney disease[J]. Int Urol Nephrol, 2023, 55(8): 1977-1984.
4	VOLBEDA M, JOU-VALENCIA D, van den HEUVEL M C, et al. Acute and chronic histopathological findings in renal biopsies in COVID-19[J]. Clin Exp Med, 2023, 23(4): 1003-1014.
5	陈成, 张小容, 鞠振宇, 等. 新型冠状病毒肺炎引发细胞因子风暴的机制及相关免疫治疗研究进展[J]. 中华烧伤杂志, 2020, 36(6): 471-475.
	CHEN C, ZHANG X R, JU Z Y, et al. Advances in the research of mechanism and related immunotherapy on the cytokine storm induced by coronavirus disease 2019[J]. Zhonghua Shao Shang Za Zhi, 2020, 36(6): 471-475.
6	JIANG Y Z, RUBIN L, PENG T M, et al. Cytokine storm in COVID-19: from viral infection to immune responses, diagnosis and therapy[J]. Int J Biol Sci, 2022, 18(2): 459-472.
7	CHEUNG M D, ERMAN E N, MOORE K H, et al. Resident macrophage subpopulations occupy distinct microenvironments in the kidney[J]. JCI Insight, 2022, 7(20): e161078.
8	KHAN S, SHAFIEI M S, LONGORIA C, et al. SARS-CoV-2 spike protein induces inflammation via TLR2-dependent activation of the NF-κB pathway[J]. eLife, 2021, 10: e68563.
9	SCARPIONI R, VALSANIA T, ALBERTAZZI V, et al. Acute kidney injury, a common and severe complication in hospitalized patients during the COVID-19 pandemic[J]. J Nephrol, 2021, 34(4): 1019-1024.
10	VAIDYA V S, FERGUSON M A, BONVENTRE J V. Biomarkers of acute kidney injury[J]. Annu Rev Pharmacol Toxicol, 2008, 48: 463-493.
11	LIU H C, XU X, DENG X, et al. Projecting the potential impact of an Omicron XBB.1.5 wave in Shanghai, China[EB/OL]. medRxiv preprint, medRxiv: 2023:2023.05.10.23289761 (2023-05-10) [2024-05-20]. https://www.medrxiv.org/content/10.1101/2023.05.10.23289761v1.full.pdf
12	ZHANG X X, ZHANG W H, CHEN S J. Shanghai′s life-saving efforts against the current Omicron wave of the COVID-19 pandemic[J]. Lancet, 2022, 399(10340): 2011-2012.
13	SILVER S A, BEAUBIEN-SOULIGNY W, SHAH P S, et al. The prevalence of acute kidney injury in patients hospitalized with COVID-19 infection: a systematic review and meta-analysis[J]. Kidney Med, 2021, 3(1): 83-98.e1.
14	ZHENG X Z, ZHAO Y L, YANG L. Acute kidney injury in COVID-19: the Chinese experience[J]. Semin Nephrol, 2020, 40(5): 430-442.
15	CHEN K H, LEI Y, HE Y N, et al. Clinical outcomes of hospitalized COVID-19 patients with renal injury: a multi-hospital observational study from Wuhan[J]. Sci Rep, 2021, 11(1): 15205.
16	LIU R, WANG Y, LI J, et al. Decreased T cell populations contribute to the increased severity of COVID-19[J]. Clin Chim Acta, 2020, 508: 110-114.
17	DIAO B, WANG C H, TAN Y J, et al. Reduction and functional exhaustion of T cells in patients with coronavirus disease 2019 (COVID-19)[J]. Front Immunol, 2020, 11: 827.
18	WILLIAMS R O, FELDMANN M, MAINI R N. Anti-tumor necrosis factor ameliorates joint disease in murine collagen-induced arthritis[J]. Proc Natl Acad Sci U S A, 1992, 89(20): 9784-9788.
19	XU X L, HAN M F, LI T T, et al. Effective treatment of severe COVID-19 patients with tocilizumab[J]. Proc Natl Acad Sci USA, 2020, 117(20): 10970-10975.
20	WANG J J, YANG X J, LI Y S, et al. Specific cytokines in the inflammatory cytokine storm of patients with COVID-19-associated acute respiratory distress syndrome and extrapulmonary multiple-organ dysfunction[J]. Virol J, 2021, 18(1): 117.
21	MEDEIROS T, GUIMARÃES G M C, CARVALHO F R, et al. Acute kidney injury associated to COVID-19 leads to a strong unbalance of circulant immune mediators[J]. Cytokine, 2022, 157: 155974.
22	SHIRATO K, KIZAKI T. SARS-CoV-2 spike protein S1 subunit induces pro-inflammatory responses via toll-like receptor 4 signaling in murine and human macrophages[J]. Heliyon, 2021, 7(2): e06187.
23	ZHAO Y C, KUANG M, LI J H, et al. SARS-CoV-2 spike protein interacts with and activates TLR41[J]. Cell Res, 2021, 31(7): 818-820.
24	CHIOK K, HUTCHISON K, MILLER L G, et al. Proinflammatory responses in SARS-CoV-2 and soluble spike glycoprotein S1 subunit activated human macrophages[J]. Viruses, 2023, 15(3): 754.
25	DIAMOND J R, PESEK I. Glomerular tumor necrosis factor and interleukin 1 during acute aminonucleoside nephrosis. An immunohistochemical study[J]. Lab Invest, 1991, 64(1): 21-28.
26	TIPPING P G, LEONG T W, HOLDSWORTH S R. Tumor necrosis factor production by glomerular macrophages in anti-glomerular basement membrane glomerulonephritis in rabbits[J]. Lab Invest, 1991, 65(3): 272-279.
27	LIAN Q Z, ZHANG K, ZHANG Z, et al. Differential effects of macrophage subtypes on SARS-CoV-2 infection in a human pluripotent stem cell-derived model[J]. Nat Commun, 2022, 13(1): 2028.
28	NEALE T J, RÜGER B M, MACAULAY H, et al. Tumor necrosis factor-alpha is expressed by glomerular visceral epithelial cells in human membranous nephropathy[J]. Am J Pathol, 1995, 146(6): 1444-1454.
29	CANTERO-NAVARRO E, RAYEGO-MATEOS S, OREJUDO M, et al. Role of macrophages and related cytokines in kidney disease[J]. Front Med (Lausanne), 2021, 8: 688060.

Target gene	Primer sequence (5′→3′)
IL1-β	Forward	ATGATGGCTTATTACAGTGGCAA
IL1-β	Reverse	GTCGGAGATTCGTAGCTGGA
TNF-α	Forward	CTCTTCTGCCTGCTGCACTTTG
TNF-α	Reverse	ATGGGCTACAGGCTTGTCACTC
CXCL10	Forward	GTGGCATTCAAGGAGTACCTC
CXCL10	Reverse	TGATGGCCTTCGATTCTGGATT
ACTB	Forward	CACCATTGGCAATGAGCGGTTC
ACTB	Reverse	AGGTCTTTGCGGATGTCCACGT
GAPDH	Forward	GGAGCGAGATCCCTCCAAAAT
GAPDH	Reverse	GGCTGTTGTCATACTTCTCATGG

Target gene	Primer sequence (5′→3′)
IL1-β	Forward	ATGATGGCTTATTACAGTGGCAA
IL1-β	Reverse	GTCGGAGATTCGTAGCTGGA
TNF-α	Forward	CTCTTCTGCCTGCTGCACTTTG
TNF-α	Reverse	ATGGGCTACAGGCTTGTCACTC
CXCL10	Forward	GTGGCATTCAAGGAGTACCTC
CXCL10	Reverse	TGATGGCCTTCGATTCTGGATT
ACTB	Forward	CACCATTGGCAATGAGCGGTTC
ACTB	Reverse	AGGTCTTTGCGGATGTCCACGT
GAPDH	Forward	GGAGCGAGATCCCTCCAAAAT
GAPDH	Reverse	GGCTGTTGTCATACTTCTCATGG

Item	Sex			Age group			Severity of pneumonia
Item	Male	Female	P value	≤60 years	>60 years	P value	Moderate	Severe	P value
WBC/(10⁹‧L^-1)	8.82±4.40	6.00±3.50	0.065	5.67±2.40	7.92±4.40	0.355	8.05±4.90	7.39±3.80	0.910
Neutrophil/%	77.06±14.70	77.92±10.90	0.808	77.57±6.40	77.39±13.80	0.437	72.86±16.10	80.88±9.30	0.100
Lymphocyte/%	15.21±13.50	15.32±9.50	0.830	15.57±4.80	15.22±12.60	0.355	19.96±15.50	11.67±6.80	0.060
Monocyte/%	6.74±3.60	5.82±2.30	0.368	6.40±4.20	6.36±3.10	0.721	6.19±2.80	6.50±3.50	0.734
Platelet/(10⁹‧L^-1)	211.95±100.80	199.66±90.50	0.775	282.75±139.40	197.78±87.50	0.585	202.25±54.00	210.57±119.30	1.000
CD3⁺ T cell/µL^-1	519.81±359.10	538.20±335.50	0.914	719.00±190.50	504.03±354.10	0.078	641.50±398.40	440.23±277.30	0.050
CD4⁺ T cell/µL^-1	255.63±143.80	318.60±237.90	0.722	386.75±127.70	268.36±190.60	0.156	309.62±152.40	259.47±211.10	0.137
CD8⁺ T cell/µL^-1	242.59±278.90	198.73±148.20	0.643	323.75±223.00	212.81±234.80	0.261	298.18±321.20	168.90±113.60	0.104
B cell/µL^-1	491.95±1 832.50	133.66±124.40	0.734	159.50±119.20	369.39±1 496.60	0.463	673.25±2 140.70	97.90±82.10	0.122
NK cell/µL^-1	154.63±118.50	145.60±224.80	0.205	123.00±113.40	154.36±173.30	0.642	155.93±124.90	147.19±196.00	0.263

Item	Sex			Age group			Severity of pneumonia
Item	Male	Female	P value	≤60 years	>60 years	P value	Moderate	Severe	P value
WBC/(10⁹‧L^-1)	8.82±4.40	6.00±3.50	0.065	5.67±2.40	7.92±4.40	0.355	8.05±4.90	7.39±3.80	0.910
Neutrophil/%	77.06±14.70	77.92±10.90	0.808	77.57±6.40	77.39±13.80	0.437	72.86±16.10	80.88±9.30	0.100
Lymphocyte/%	15.21±13.50	15.32±9.50	0.830	15.57±4.80	15.22±12.60	0.355	19.96±15.50	11.67±6.80	0.060
Monocyte/%	6.74±3.60	5.82±2.30	0.368	6.40±4.20	6.36±3.10	0.721	6.19±2.80	6.50±3.50	0.734
Platelet/(10⁹‧L^-1)	211.95±100.80	199.66±90.50	0.775	282.75±139.40	197.78±87.50	0.585	202.25±54.00	210.57±119.30	1.000
CD3⁺ T cell/µL^-1	519.81±359.10	538.20±335.50	0.914	719.00±190.50	504.03±354.10	0.078	641.50±398.40	440.23±277.30	0.050
CD4⁺ T cell/µL^-1	255.63±143.80	318.60±237.90	0.722	386.75±127.70	268.36±190.60	0.156	309.62±152.40	259.47±211.10	0.137
CD8⁺ T cell/µL^-1	242.59±278.90	198.73±148.20	0.643	323.75±223.00	212.81±234.80	0.261	298.18±321.20	168.90±113.60	0.104
B cell/µL^-1	491.95±1 832.50	133.66±124.40	0.734	159.50±119.20	369.39±1 496.60	0.463	673.25±2 140.70	97.90±82.10	0.122
NK cell/µL^-1	154.63±118.50	145.60±224.80	0.205	123.00±113.40	154.36±173.30	0.642	155.93±124.90	147.19±196.00	0.263

Group	Creatinine level in COVID-19 cohort/(µmol‧L^-1)			Status of KI
Group	Mean	Min. value	Max. value	KI/n (%)	Non-KI/n (%)	P value
Total	113.30±166.20	36.00	1 041.00	8 (20.50)	31 (79.50)
Gender						0.575
Male	140.73±211.40	36.00	1 041.00	5 (21.70)	18 (78.30)
Female	73.87±40.30	38.00	175.00	3 (18.70)	13 (81.30)
Age/year						0.171
≤60	249.20±442.80	38.00	1 041.00	1 (20.00)	4 (80.00)
61‒70	80.62±65.50	36.00	236.00	1 (12.50)	7 (87.50)
71‒80	87.28±73.90	40.00	336.00	1 (7.10)	13 (92.90)
>80	108.83±70.00	56.00	294.00	5 (41.70)	7 (58.30)