
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2025, Vol. 45 ›› Issue (1): 1-10.doi: 10.3969/j.issn.1674-8115.2025.01.001
• Basic research • Next Articles
PANDIT Roshan1(
), LU Junyao2(
), HE Liheng1, BAO Yujie2, JI Ping1, CHEN Yingying1, XU Jie2,3(
), WANG Ying1,3(
)
Accepted:2024-08-16
Online:2025-01-28
Published:2025-01-28
Contact:
XU Jie, WANG Ying
E-mail:p_roshan@sjtu.edu.cn;lu_junyao@163.com;dr.xu@aliyun.com;ywangssmu@shsmu.edu.cn
Supported by:CLC Number:
PANDIT Roshan, LU Junyao, HE Liheng, BAO Yujie, JI Ping, CHEN Yingying, XU Jie, WANG Ying. Role of tumor necrosis factor-α in coronavirus disease 2019-associated kidney injury[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025,(1): 1-10.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2025.01.001
| Target gene | Primer sequence (5′→3′) | |
|---|---|---|
| IL1-β | Forward | ATGATGGCTTATTACAGTGGCAA |
| Reverse | GTCGGAGATTCGTAGCTGGA | |
| TNF-α | Forward | CTCTTCTGCCTGCTGCACTTTG |
| Reverse | ATGGGCTACAGGCTTGTCACTC | |
| CXCL10 | Forward | GTGGCATTCAAGGAGTACCTC |
| Reverse | TGATGGCCTTCGATTCTGGATT | |
| ACTB | Forward | CACCATTGGCAATGAGCGGTTC |
| Reverse | AGGTCTTTGCGGATGTCCACGT | |
| GAPDH | Forward | GGAGCGAGATCCCTCCAAAAT |
| Reverse | GGCTGTTGTCATACTTCTCATGG | |
Tab 1 Primer sequences used in RT-PCR
| Target gene | Primer sequence (5′→3′) | |
|---|---|---|
| IL1-β | Forward | ATGATGGCTTATTACAGTGGCAA |
| Reverse | GTCGGAGATTCGTAGCTGGA | |
| TNF-α | Forward | CTCTTCTGCCTGCTGCACTTTG |
| Reverse | ATGGGCTACAGGCTTGTCACTC | |
| CXCL10 | Forward | GTGGCATTCAAGGAGTACCTC |
| Reverse | TGATGGCCTTCGATTCTGGATT | |
| ACTB | Forward | CACCATTGGCAATGAGCGGTTC |
| Reverse | AGGTCTTTGCGGATGTCCACGT | |
| GAPDH | Forward | GGAGCGAGATCCCTCCAAAAT |
| Reverse | GGCTGTTGTCATACTTCTCATGG | |
| Item | Sex | Age group | Severity of pneumonia | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Male | Female | P value | ≤60 years | >60 years | P value | Moderate | Severe | P value | |
| WBC/(109‧L-1) | 8.82±4.40 | 6.00±3.50 | 0.065 | 5.67±2.40 | 7.92±4.40 | 0.355 | 8.05±4.90 | 7.39±3.80 | 0.910 |
| Neutrophil/% | 77.06±14.70 | 77.92±10.90 | 0.808 | 77.57±6.40 | 77.39±13.80 | 0.437 | 72.86±16.10 | 80.88±9.30 | 0.100 |
| Lymphocyte/% | 15.21±13.50 | 15.32±9.50 | 0.830 | 15.57±4.80 | 15.22±12.60 | 0.355 | 19.96±15.50 | 11.67±6.80 | 0.060 |
| Monocyte/% | 6.74±3.60 | 5.82±2.30 | 0.368 | 6.40±4.20 | 6.36±3.10 | 0.721 | 6.19±2.80 | 6.50±3.50 | 0.734 |
| Platelet/(109‧L-1) | 211.95±100.80 | 199.66±90.50 | 0.775 | 282.75±139.40 | 197.78±87.50 | 0.585 | 202.25±54.00 | 210.57±119.30 | 1.000 |
| CD3+ T cell/µL-1 | 519.81±359.10 | 538.20±335.50 | 0.914 | 719.00±190.50 | 504.03±354.10 | 0.078 | 641.50±398.40 | 440.23±277.30 | 0.050 |
| CD4+ T cell/µL-1 | 255.63±143.80 | 318.60±237.90 | 0.722 | 386.75±127.70 | 268.36±190.60 | 0.156 | 309.62±152.40 | 259.47±211.10 | 0.137 |
| CD8+ T cell/µL-1 | 242.59±278.90 | 198.73±148.20 | 0.643 | 323.75±223.00 | 212.81±234.80 | 0.261 | 298.18±321.20 | 168.90±113.60 | 0.104 |
| B cell/µL-1 | 491.95±1 832.50 | 133.66±124.40 | 0.734 | 159.50±119.20 | 369.39±1 496.60 | 0.463 | 673.25±2 140.70 | 97.90±82.10 | 0.122 |
| NK cell/µL-1 | 154.63±118.50 | 145.60±224.80 | 0.205 | 123.00±113.40 | 154.36±173.30 | 0.642 | 155.93±124.90 | 147.19±196.00 | 0.263 |
Tab 2 Comparisons of peripheral immune cell numbers in COVID-19 patients
| Item | Sex | Age group | Severity of pneumonia | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Male | Female | P value | ≤60 years | >60 years | P value | Moderate | Severe | P value | |
| WBC/(109‧L-1) | 8.82±4.40 | 6.00±3.50 | 0.065 | 5.67±2.40 | 7.92±4.40 | 0.355 | 8.05±4.90 | 7.39±3.80 | 0.910 |
| Neutrophil/% | 77.06±14.70 | 77.92±10.90 | 0.808 | 77.57±6.40 | 77.39±13.80 | 0.437 | 72.86±16.10 | 80.88±9.30 | 0.100 |
| Lymphocyte/% | 15.21±13.50 | 15.32±9.50 | 0.830 | 15.57±4.80 | 15.22±12.60 | 0.355 | 19.96±15.50 | 11.67±6.80 | 0.060 |
| Monocyte/% | 6.74±3.60 | 5.82±2.30 | 0.368 | 6.40±4.20 | 6.36±3.10 | 0.721 | 6.19±2.80 | 6.50±3.50 | 0.734 |
| Platelet/(109‧L-1) | 211.95±100.80 | 199.66±90.50 | 0.775 | 282.75±139.40 | 197.78±87.50 | 0.585 | 202.25±54.00 | 210.57±119.30 | 1.000 |
| CD3+ T cell/µL-1 | 519.81±359.10 | 538.20±335.50 | 0.914 | 719.00±190.50 | 504.03±354.10 | 0.078 | 641.50±398.40 | 440.23±277.30 | 0.050 |
| CD4+ T cell/µL-1 | 255.63±143.80 | 318.60±237.90 | 0.722 | 386.75±127.70 | 268.36±190.60 | 0.156 | 309.62±152.40 | 259.47±211.10 | 0.137 |
| CD8+ T cell/µL-1 | 242.59±278.90 | 198.73±148.20 | 0.643 | 323.75±223.00 | 212.81±234.80 | 0.261 | 298.18±321.20 | 168.90±113.60 | 0.104 |
| B cell/µL-1 | 491.95±1 832.50 | 133.66±124.40 | 0.734 | 159.50±119.20 | 369.39±1 496.60 | 0.463 | 673.25±2 140.70 | 97.90±82.10 | 0.122 |
| NK cell/µL-1 | 154.63±118.50 | 145.60±224.80 | 0.205 | 123.00±113.40 | 154.36±173.30 | 0.642 | 155.93±124.90 | 147.19±196.00 | 0.263 |
| Group | Creatinine level in COVID-19 cohort/(µmol‧L-1) | Status of KI | ||||
|---|---|---|---|---|---|---|
| Mean | Min. value | Max. value | KI/n (%) | Non-KI/n (%) | P value | |
| Total | 113.30±166.20 | 36.00 | 1 041.00 | 8 (20.50) | 31 (79.50) | |
| Gender | 0.575 | |||||
| Male | 140.73±211.40 | 36.00 | 1 041.00 | 5 (21.70) | 18 (78.30) | |
| Female | 73.87±40.30 | 38.00 | 175.00 | 3 (18.70) | 13 (81.30) | |
| Age/year | 0.171 | |||||
| ≤60 | 249.20±442.80 | 38.00 | 1 041.00 | 1 (20.00) | 4 (80.00) | |
| 61‒70 | 80.62±65.50 | 36.00 | 236.00 | 1 (12.50) | 7 (87.50) | |
| 71‒80 | 87.28±73.90 | 40.00 | 336.00 | 1 (7.10) | 13 (92.90) | |
| >80 | 108.83±70.00 | 56.00 | 294.00 | 5 (41.70) | 7 (58.30) | |
Tab 3 Serum creatinine levels and kidney injury (KI) in COVID-19 patients
| Group | Creatinine level in COVID-19 cohort/(µmol‧L-1) | Status of KI | ||||
|---|---|---|---|---|---|---|
| Mean | Min. value | Max. value | KI/n (%) | Non-KI/n (%) | P value | |
| Total | 113.30±166.20 | 36.00 | 1 041.00 | 8 (20.50) | 31 (79.50) | |
| Gender | 0.575 | |||||
| Male | 140.73±211.40 | 36.00 | 1 041.00 | 5 (21.70) | 18 (78.30) | |
| Female | 73.87±40.30 | 38.00 | 175.00 | 3 (18.70) | 13 (81.30) | |
| Age/year | 0.171 | |||||
| ≤60 | 249.20±442.80 | 38.00 | 1 041.00 | 1 (20.00) | 4 (80.00) | |
| 61‒70 | 80.62±65.50 | 36.00 | 236.00 | 1 (12.50) | 7 (87.50) | |
| 71‒80 | 87.28±73.90 | 40.00 | 336.00 | 1 (7.10) | 13 (92.90) | |
| >80 | 108.83±70.00 | 56.00 | 294.00 | 5 (41.70) | 7 (58.30) | |
| 1 | MOKHTARI T, HASSANI F, GHAFFARI N, et al. COVID-19 and multiorgan failure: a narrative review on potential mechanisms[J]. J Mol Histol, 2020, 51(6): 613-628. |
| 2 | JEWELL P D, BRAMHAM K, GALLOWAY J, et al. COVID-19-related acute kidney injury; incidence, risk factors and outcomes in a large UK cohort[J]. BMC Nephrol, 2021, 22(1): 359. |
| 3 | SCHIFFL H, LANG S M. Long-term interplay between COVID-19 and chronic kidney disease[J]. Int Urol Nephrol, 2023, 55(8): 1977-1984. |
| 4 | VOLBEDA M, JOU-VALENCIA D, van den HEUVEL M C, et al. Acute and chronic histopathological findings in renal biopsies in COVID-19[J]. Clin Exp Med, 2023, 23(4): 1003-1014. |
| 5 | 陈成, 张小容, 鞠振宇, 等. 新型冠状病毒肺炎引发细胞因子风暴的机制及相关免疫治疗研究进展[J]. 中华烧伤杂志, 2020, 36(6): 471-475. |
| CHEN C, ZHANG X R, JU Z Y, et al. Advances in the research of mechanism and related immunotherapy on the cytokine storm induced by coronavirus disease 2019[J]. Zhonghua Shao Shang Za Zhi, 2020, 36(6): 471-475. | |
| 6 | JIANG Y Z, RUBIN L, PENG T M, et al. Cytokine storm in COVID-19: from viral infection to immune responses, diagnosis and therapy[J]. Int J Biol Sci, 2022, 18(2): 459-472. |
| 7 | CHEUNG M D, ERMAN E N, MOORE K H, et al. Resident macrophage subpopulations occupy distinct microenvironments in the kidney[J]. JCI Insight, 2022, 7(20): e161078. |
| 8 | KHAN S, SHAFIEI M S, LONGORIA C, et al. SARS-CoV-2 spike protein induces inflammation via TLR2-dependent activation of the NF-κB pathway[J]. eLife, 2021, 10: e68563. |
| 9 | SCARPIONI R, VALSANIA T, ALBERTAZZI V, et al. Acute kidney injury, a common and severe complication in hospitalized patients during the COVID-19 pandemic[J]. J Nephrol, 2021, 34(4): 1019-1024. |
| 10 | VAIDYA V S, FERGUSON M A, BONVENTRE J V. Biomarkers of acute kidney injury[J]. Annu Rev Pharmacol Toxicol, 2008, 48: 463-493. |
| 11 | LIU H C, XU X, DENG X, et al. Projecting the potential impact of an Omicron XBB.1.5 wave in Shanghai, China[EB/OL]. medRxiv preprint, medRxiv: 2023:2023.05.10.23289761 (2023-05-10) [2024-05-20]. https://www.medrxiv.org/content/10.1101/2023.05.10.23289761v1.full.pdf |
| 12 | ZHANG X X, ZHANG W H, CHEN S J. Shanghai′s life-saving efforts against the current Omicron wave of the COVID-19 pandemic[J]. Lancet, 2022, 399(10340): 2011-2012. |
| 13 | SILVER S A, BEAUBIEN-SOULIGNY W, SHAH P S, et al. The prevalence of acute kidney injury in patients hospitalized with COVID-19 infection: a systematic review and meta-analysis[J]. Kidney Med, 2021, 3(1): 83-98.e1. |
| 14 | ZHENG X Z, ZHAO Y L, YANG L. Acute kidney injury in COVID-19: the Chinese experience[J]. Semin Nephrol, 2020, 40(5): 430-442. |
| 15 | CHEN K H, LEI Y, HE Y N, et al. Clinical outcomes of hospitalized COVID-19 patients with renal injury: a multi-hospital observational study from Wuhan[J]. Sci Rep, 2021, 11(1): 15205. |
| 16 | LIU R, WANG Y, LI J, et al. Decreased T cell populations contribute to the increased severity of COVID-19[J]. Clin Chim Acta, 2020, 508: 110-114. |
| 17 | DIAO B, WANG C H, TAN Y J, et al. Reduction and functional exhaustion of T cells in patients with coronavirus disease 2019 (COVID-19)[J]. Front Immunol, 2020, 11: 827. |
| 18 | WILLIAMS R O, FELDMANN M, MAINI R N. Anti-tumor necrosis factor ameliorates joint disease in murine collagen-induced arthritis[J]. Proc Natl Acad Sci U S A, 1992, 89(20): 9784-9788. |
| 19 | XU X L, HAN M F, LI T T, et al. Effective treatment of severe COVID-19 patients with tocilizumab[J]. Proc Natl Acad Sci USA, 2020, 117(20): 10970-10975. |
| 20 | WANG J J, YANG X J, LI Y S, et al. Specific cytokines in the inflammatory cytokine storm of patients with COVID-19-associated acute respiratory distress syndrome and extrapulmonary multiple-organ dysfunction[J]. Virol J, 2021, 18(1): 117. |
| 21 | MEDEIROS T, GUIMARÃES G M C, CARVALHO F R, et al. Acute kidney injury associated to COVID-19 leads to a strong unbalance of circulant immune mediators[J]. Cytokine, 2022, 157: 155974. |
| 22 | SHIRATO K, KIZAKI T. SARS-CoV-2 spike protein S1 subunit induces pro-inflammatory responses via toll-like receptor 4 signaling in murine and human macrophages[J]. Heliyon, 2021, 7(2): e06187. |
| 23 | ZHAO Y C, KUANG M, LI J H, et al. SARS-CoV-2 spike protein interacts with and activates TLR41[J]. Cell Res, 2021, 31(7): 818-820. |
| 24 | CHIOK K, HUTCHISON K, MILLER L G, et al. Proinflammatory responses in SARS-CoV-2 and soluble spike glycoprotein S1 subunit activated human macrophages[J]. Viruses, 2023, 15(3): 754. |
| 25 | DIAMOND J R, PESEK I. Glomerular tumor necrosis factor and interleukin 1 during acute aminonucleoside nephrosis. An immunohistochemical study[J]. Lab Invest, 1991, 64(1): 21-28. |
| 26 | TIPPING P G, LEONG T W, HOLDSWORTH S R. Tumor necrosis factor production by glomerular macrophages in anti-glomerular basement membrane glomerulonephritis in rabbits[J]. Lab Invest, 1991, 65(3): 272-279. |
| 27 | LIAN Q Z, ZHANG K, ZHANG Z, et al. Differential effects of macrophage subtypes on SARS-CoV-2 infection in a human pluripotent stem cell-derived model[J]. Nat Commun, 2022, 13(1): 2028. |
| 28 | NEALE T J, RÜGER B M, MACAULAY H, et al. Tumor necrosis factor-alpha is expressed by glomerular visceral epithelial cells in human membranous nephropathy[J]. Am J Pathol, 1995, 146(6): 1444-1454. |
| 29 | CANTERO-NAVARRO E, RAYEGO-MATEOS S, OREJUDO M, et al. Role of macrophages and related cytokines in kidney disease[J]. Front Med (Lausanne), 2021, 8: 688060. |
| [1] | Feng Haoran, Liu Junjun, Wang Kaichun, Wang Niansong, Gu Sijie, Fan Ying. Mechanism of WNT5A in aggravating the ischemia-reperfusion injury-induced acute kidney injury to chronic kidney disease transition by promoting FOXP1 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(7): 875-885. |
| [2] | Quyang Danzeng, Xiao Huoyuan, Zhang Qingchen, Liu Yuting, Kang Sang, Feng Rui, Pan Jingwei. Diagnostic value of cardiac magnetic resonance for myocardial injury in patients with mild COVID-19 infection [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(3): 322-331. |
| [3] | Ying Yiwen, Li Shu, Zhang Zhen, Yu Jingran, Zhang Ning, Mou Shan. Analysis of clinical characteristics and pregnancy outcomes of pregnancy-related acute kidney injury among high-risk pregnancy populations [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(1): 60-65. |
| [4] | LI Qianyu, QIAN Yifei, LI Songling, ZHU Zijun, QIN Wenli, LIU Yanfeng, QIU Bijun. Function and mechanism of suppressor of zeste 12 in hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1138-1148. |
| [5] | FAN Qiang, WU Guangbo, ZHAO Jinbo, ZHENG Lei, LUO Meng. Research progress in pathophysiological and molecular mechanism changes during decompensated phase of portal hypertension in liver cirrhosis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(3): 379-384. |
| [6] | LI Qianyu, GUO Wenyun, QIAN Yifei, LI Songling, ZHU Zijun, LIU Yanfeng. Study on the significance and mechanism of ASGR1 in hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(9): 1107-1114. |
| [7] | XIE Lin, CHENG Ye, ZHENG Qimin, ZHANG Xi, FU Lili, CHEN Min, WANG Yi, MEI Changlin, XIE Jingyuan, GU Xiangchen. Preventive effect of icariin on transition from acute kidney injury to chronic kidney disease in mouse model [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 8-19. |
| [8] | ZHANG Yutang, JIN Yijie, ZHANG Fengchun, XU Yingchun. Exploration on rationalization of diagnosis and treatment of breast cancer patients combined with COVID-19 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(12): 1745-1750. |
| [9] | HU Chanchan, FAN Yi, XU Yuan, HU Zhijian, ZENG Yiming. Lipid metabolism and lung cancer: emerging roles in occurrence, progression, diagnosis and treatment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(12): 1766-1771. |
| [10] | Lei XIONG, Qian YI, Ming-fang XU, Jian CHEN. Expression and prognosis analysis of MRPL12 in lung adenocarcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1033-1040. |
| [11] | Jiang YUE, Yong ZHOU, Hua XU, Wen LIU, Xiao-feng HAN, Qing MAO, Ji-dong ZHANG, Jing MA, Han-dong JIANG, Wei LIU. Characteristic analysis and comparison of glycolipid metabolism in patients with coronavirus disease 2019 in common condition and severe cases [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(3): 355-359. |
| [12] | Jian-xiao SHEN, Wan-peng WANG, Xing-hua SHAO, Jing-kui WU, Shu LI, Xia-jing CHE, Zhao-hui NI. Changes of m6A methylation in renal tissue during cisplatin-induced acute injury [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(12): 1603-1611. |
| [13] | Guan-wen HUANG, Ji-wen BAO, Zi-yang LI, Min-fang ZHANG, Wen-yan ZHOU, Qin WANG, Zhao-hui NI, Ling WANG. Predictive value of soluble interleukin-2 receptor and tumor necrosis factor-α in disease activity of lupus nephritis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(1): 55-61. |
| [14] | WANG Lin1, 2, JIANG Li-ping2, 3, YANG Yan2, 4, LIN Wei-dong1, 2, ZHANG Ya-qing2, 5. Study on nursing emergency management strategy of general hospitals in non-epidemic areas under the outbreak of coronavirus disease 2019 [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(8): 1005-1008. |
| [15] | SHI Da-ke, HU Wei-guo, YANG Zhi-tao, LIN Jing-sheng, WANG Xiao-ning, GUO Ying, QIAN Wen-jing, CAI Ming, XIANG Xiao-gang, LIANG Xiao-hong, ZHAI Rong-cheng, ZHANG Yi-bo, NI Yu-Xing. Experience of healthcare-acquired infection control against coronavirus disease 2019 by integrated medical team in Wuhan [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(8): 1009-1012. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||