Effect of ferroptosis on regeneration after muscle injury

doi:10.3969/j.issn.1674-8115.2022.03.006

Abstract

Abstract: Objective

·To investigate the role of ferroptosis in muscle regeneration after injury induced by cardiotoxin (CTX).

Methods

·CTX was injected into the tibialis anterior (TA) of fifteen 8-week-old male C57BL/6J mice at the upper, middle and lower points. After injection, TA tissue of the mice was collected at 0 d, 3 d and 7 d respectively (n=5) to detect injury by hematoxylin-eosin (H-E) staining. Meanwhile, quantitative real-time PCR (qPCR) and Western blotting were used respectively to detect the expression levels of muscle regeneration-related indexes and ferroptosis-related genes from RNA and protein levels, respectively. At the same time, forty-five 8-week-old C57BL/6J male mice were divided into 3 groups before CTX injection: saline control group, iron chelator deferoxamine (DFO) treatment group and ferroptosis inhibitor UAMC-3203 treatment group (n=15). CTX was injected into TA, and muscle tissue was collected at 0 d, 3 d and 7 d respectively. RNA sequencing (RNA-seq) technology and bioinformatics were used to analyze the effect of ferroptosis inhibitor pretreatment on muscle injury and regeneration after CTX injection. H-E staining and qPCR were utilized to analyze the effect of ferroptosis inhibitor on the expression levels of muscle regeneration-related genes.

Results

·The muscle injury and regeneration model was successfully established by CTX injection, as revealed by H-E staining. The increase of ferroptosis-related genes including acyl-CoA synthetase long chain family member 4 (Acsl4) and heme oxygenase-1 (Hmox-1) at both RNA and protein levels was observed, suggesting the occurrence of ferroptosis during muscle injury. There was severe muscle injury at day 3, which was detected by the up-regulation of myogenic differentiation antigen (Myod), myogenin (Myog), and tenascin-c (Tnc), followed by declines at day 7. According to the analysis of Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway of RNA-seq differential genes, it was found that UAMC-3203 treatment group had significant changes in neutrophil degranulation, production of reactive oxygen species (ROS) and phospholipids in phagocytosis compared with CTX injection alone. And the expression of cathepsin S (Ctss) was much higher in the UAMC-3203 treatment group. More importantly, the expression of muscle regeneration-related genes were dramatically inhibited by both UAMC-3203 and DFO injection.

Conclusion

·Inhibition of ferroptosis slows down the process of muscle regeneration to a certain degree, suggesting that ferroptosis may play a key role in facilitating muscle regeneration.

Key words: ferroptosis, muscle injury, muscle regeneration, cardiotoxin (CTX)

CLC Number:

R363.1

DU Yuting, ZHANG Jing, HUANG Ying, ZHANG Jing. Effect of ferroptosis on regeneration after muscle injury[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 298-306.

Figures/Tables 5

Tab 1 Primer sequences for qPCR （5′→3′）

Gene	Forward primer	Reverse primer
Myod	CCACTCCGGGACATAGACTTG	AAAAGCGCAGGTCTGGTGAG
Myog	GAGACATCCCCCTATTTCTACCA	GCTCAGTCCGCTCATAGCC
Tnc	TTTGCCCTCACTCCCGAAG	AGGGTCATGTTTAGCCCACTC
Hmox-1	ACAGAGGAACACAAAGACCAG	GTGTCTGGGATGAGCTAGTG
Acsl4	CTCACCATTATATTGCTGCCTGT	TCTCTTTGCCATAGCGTTTTTCT
Ctss	CCATTGGGATCTCTGGAAGAAAA	TCATGCCCACTTGGTAGGTAT
Gapdh	CCCCAATGTGTCCGTCGTG	GCCTGCTTCACCACCTTCT

Fig 1 Muscle injury and regeneration induced by CTX

Fig 2 RNA and protein expression of ferroptosis-related indicators after CTX injection

Fig 3 Effect of ferroptosis inhibitors UAMC-3203 on CTX-induced skeletal muscle regeneration at transcriptome level

Fig 4 Inhibitory effect of ferroptosis inhibitor on the regeneration ability of skeletal muscle

TrendMD

References 23

1	FRONTERA W R, OCHALA J. Skeletal muscle: a brief review of structure and function[J]. Calcif Tissue Int, 2015, 96(3): 183-195.
2	BAGHDADI M B, TAJBAKHSH S. Regulation and phylogeny of skeletal muscle regeneration[J]. Dev Biol, 2018, 433(2): 200-209.
3	HUARD J, LI Y, FU F H. Muscle injuries and repair: current trends in research[J]. J Bone Joint Surg Am, 2002, 84(5): 822-832.
4	BEHM D G, BLAZEVICH A J, KAY A D, et al. Acute effects of muscle stretching on physical performance, range of motion, and injury incidence in healthy active individuals: a systematic review[J]. Appl Physiol Nutr Metab, 2016, 41(1): 1-11.
5	DALLE S, HIROUX C, POFFÉ C, et al. Cardiotoxin-induced skeletal muscle injury elicits profound changes in anabolic and stress signaling, and muscle fiber type composition[J]. J Muscle Res Cell Motil, 2020, 41(4): 375-387.
6	MATHES A L, LAFYATIS R. Role for Toll-like receptor 3 in muscle regeneration after cardiotoxin injury[J]. Muscle Nerve, 2011, 43(5): 733-740.
7	ZHOU S A, ZHANG W, CAI G H, et al. Myofiber necroptosis promotes muscle stem cell proliferation via releasing tenascin-c during regeneration[J]. Cell Res, 2020, 30(12): 1063-1077.
8	DIXON S J, LEMBERG K M, LAMPRECHT M R, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death[J]. Cell, 2012, 149(5): 1060-1072.
9	CONRAD M, ANGELI J P F, VANDENABEELE P, et al. Regulated necrosis: disease relevance and therapeutic opportunities[J]. Nat Rev Drug Discov, 2016, 15(5): 348-366.
10	KAGAN V E, MAO G W, QU F, et al. Oxidized arachidonic and adrenic PEs navigate cells to ferroptosis[J]. Nat Chem Biol, 2017, 13(1): 81-90.
11	DOLL S, PRONETH B, TYURINA Y Y, et al. ACSL4 dictates ferroptosis sensitivity by shaping cellular lipid composition[J]. Nat Chem Biol, 2017, 13(1): 91-98.
12	ANGELI J P F, SCHNEIDER M, PRONETH B, et al. Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice[J]. Nat Cell Biol, 2014, 16(12): 1180-1191.
13	INGOLD I, BERNDT C, SCHMITT S, et al. Selenium utilization by GPX4 is required to prevent hydroperoxide-induced ferroptosis[J]. Cell, 2018, 172(3): 409-422.e21.
14	YANG W S, SRIRAMARATNAM R, WELSCH M E, et al. Regulation of ferroptotic cancer cell death by GPX4[J]. Cell, 2014, 156(1-2): 317-331.
15	DEVISSCHER L, VAN COILLIE S, HOFMANS S, et al. Discovery of novel, drug-like ferroptosis inhibitors with in vivo efficacy[J]. J Med Chem, 2018, 61(22): 10126-10140.
16	DIXON S J, STOCKWELL B R. The hallmarks of ferroptosis[J]. Annu Rev Cancer Biol, 2019, 3: 35-54.
17	JIANG X J, STOCKWELL B R, CONRAD M. Ferroptosis: mechanisms, biology and role in disease[J]. Nat Rev Mol Cell Biol, 2021, 22(4): 266-282.
18	SOUSA-VICTOR P, GARCÍA-PRAT L, MUÑOZ-CÁNOVES P. Control of satellite cell function in muscle regeneration and its disruption in ageing[J]. Nat Rev Mol Cell Biol, 2021. DOI: 10.1038/s41580-021-00421-2.
19	WANG H Y, HUANG Y L, YU M, et al. Muscle regeneration controlled by a designated DNA dioxygenase[J]. Cell Death Dis, 2021, 12(6): 535.
20	TIERNEY M T, GROMOVA A, SESILLO F B, et al. Autonomous extracellular matrix remodeling controls a progressive adaptation in muscle stem cell regenerative capacity during development[J]. Cell Rep, 2016, 14(8): 1940-1952.
21	TJONDROKOESOEMO A, SCHIPS T G, SARGENT M A, et al. Cathepsin S contributes to the pathogenesis of muscular dystrophy in mice[J]. J Biol Chem, 2016, 291(19): 9920-9928.
22	MORGAN J E, PROLA A, MARIOT V, et al. Necroptosis mediates myofibre death in dystrophin-deficient mice[J]. Nat Commun, 2018, 9(1): 3655.
23	SREENIVASAN K, IANNI A, KÜNNE C, et al. Attenuated epigenetic suppression of muscle stem cell necroptosis is required for efficient regeneration of dystrophic muscles[J]. Cell Rep, 2020, 31(7): 107652.

[1]	Qian WEI, Ying-ting ZHANG, Long-shuai LIN, En-jun HE, Yong-yuan HE, Ying-hong SU, Cheng-cheng DUAN, Si-yuan WANG, Qing-hua ZHAO, Qian ZHAO, Ming HE. Haptoglobin suppresses hepatocyte ferroptosis via inhibition of the ERK1/2 signaling pathway [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 999-1008.
[2]	HE Ming, WEI Qian, ZHANG Ying-ting. Research progress in the mechanism of ferroptosis and its role in liver related diseases [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(11): 1519-1523.