Effect of decreased 5⁃hydroxytryptamine synthesis during puberty development on the onset of puberty in female rats

doi:10.3969/j.issn.1674-8115.2022.03.007

Abstract

Abstract: Objective

·To preliminarily explore the effects of decreased 5-hydroxytryptamine (5-HT) synthesis in the hypothalamus during puberty development on the onset of puberty in female rats.

Methods

·Seventy two 21-day-old female SD rats were randomly divided into para-chlorophenylalanine (PCPA) group and normal saline group (control group), with 36 rats in each group. The rats in the PCPA group were injected with PCPA intraperitoneally every day (to establish the model of decreased 5-HT synthesis), while the rats in the control group were injected with the same amount of normal saline. The administration treatment lasted until 1 d before death. The rats were sacrificed at the age of 28 days, 35 days and 42 days, respectively. The expression of gonadotropin-releasing hormone (GnRH) gene in the hypothalamus of the two groups was detected by quantitative real-time PCR (qPCR). The content of 5-HT and GnRH in the hypothalamus and the level of luteinizing hormone (LH) in peripheral blood were detected by enzyme-linked immunosorbent assay (ELISA). At the same time, since the age of 28 days, the vaginal opening time in the two groups was observed and recorded from 9:00 to 10:00.

Results

·The ELISA results of 5-HT content showed that the rats in the control group had the lowest level at 28 days and the highest level at 42 days, and showed an overall increasing trend, which was consistent with the trend of the PCPA group. Compared with the control group, the content of 5-HT in the PCPA group was lower at the above three time points (all P<0.05). qPCR and ELISA results of GnRH content showed that compared with the control group, the expressions of GnRH mRNA and GnRH protein in the PCPA group were lower at the above three time points (all P<0.05). The results of ELISA showed that compared with the control group, LH levels of the PCPA group were lower at the age of 28 days and 35 days, and the difference was statistically significant (both P<0.05). The observation results showed that compared with the control group, vaginal opening time of the PCPA group was delayed (P=0.035).

Conclusion

·The decrease of 5-HT synthesis during puberty development can lead to decrease of GnRH synthesis in the hypothalamus, decrease of LH level in peripheral blood and delay of vaginal opening, thus delaying the onset of puberty in female SD rats.

Key words: 5-hydroxytryptamine (5-HT), rat, puberty development, gonadotropin-releasing hormone (GnRH)

CLC Number:

R725.8

DONG Ting, YIN Xiaoqin, LI Yan, LI Pin. Effect of decreased 5⁃hydroxytryptamine synthesis during puberty development on the onset of puberty in female rats[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 307-311.

Figures/Tables 5

Tab 1 Primer sequences for qPCR

Gene

Forward sequence （5' →3'）

Reverse sequence

（5' →3'）

Length/bp

GnRH

CCGCTGTTGTTCTGTTGACTGTG

GGGGTTCTGCCATTTGATCCTC

150

β-actin

GTCAGGTCATCACTATCGGCAAT

AGAGGTCTTTACGGATGTCAACGT

147

Fig 1 Analysis of 5-HT content in the hypothalamus of the two groups

Fig 2 Expression of GnRH mRNA and GnRH protein in the hypothalamus of the two groups

Fig 3 Analysis of LH levels in serum of the two groups

Fig 4 Analysis of vaginal opening time in the two groups

TrendMD

References 16

1	TONSFELDT K J, SCHOELLER E L, BRUSMAN L E, et al. The contribution of the circadian gene Bmal1 to female fertility and the generation of the preovulatory luteinizing hormone surge[J]. J Endocr Soc, 2019, 3(4): 716-733.
2	LATRONICO A C, BRITO V N, CAREL J C. Causes, diagnosis, and treatment of central precocious puberty[J]. Lancet Diabetes Endocrinol, 2016, 4(3): 265-274.
3	ABBASI J. Chemicals in consumer products associated with early puberty[J]. JAMA, 2019, 321(16): 1556.
4	HILL J W, ELIAS C F. Neuroanatomical framework of the metabolic control of reproduction[J]. Physiol Rev, 2018, 98(4): 2349-2380.
5	AVENDAÑO M S, VAZQUEZ M J, TENA-SEMPERE M. Disentangling puberty: novel neuroendocrine pathways and mechanisms for the control of mammalian puberty[J]. Hum Reprod Update, 2017, 23(6): 737-763.
6	SPERGEL D J. Modulation of gonadotropin-releasing hormone neuron activity and secretion in mice by non-peptide neurotransmitters, gasotransmitters, and gliotransmitters[J]. Front Endocrinol (Lausanne), 2019, 10: 329.
7	CAMPBELL R E, HERBISON A E. Definition of brainstem afferents to gonadotropin-releasing hormone neurons in the mouse using conditional viral tract tracing[J]. Endocrinology, 2007, 148(12): 5884-5890.
8	GHAHERI S, NIAPOUR A, SAKHAIE N, et al. Postnatal depletion of serotonin affects the morphology of neurons and the function of the hippocampus in male rats[J]. Int J Dev Neurosci, 2022. DOI: 10.1002/jdn.10174.
9	TRUJILLO V, VALENTIM-LIMA E, MENCALHA R, et al. Neonatal serotonin depletion induces hyperactivity and anxiolytic-like sex-dependent effects in adult rats[J]. Mol Neurobiol, 2021, 58(3): 1036-1051.
10	MORAN M J, AYALA M E, GALLEGOS E, et al. Effects of systemic administration or intrabursal injection of serotonin on puberty, first ovulation and follicular development in rats[J]. Reprod Fertil Dev, 2013, 25(8): 1105-1114.
11	MARTIN A M, YOUNG R L, LEONG L, et al. The diverse metabolic roles of peripheral serotonin[J]. Endocrinology, 2017, 158(5): 1049-1063.
12	PRONINA T, UGRUMOV M, ADAMSKAYA E, et al. Influence of serotonin on the development and migration of gonadotropin-releasing hormone neurones in rat foetuses[J]. J Neuroendocrinol, 2003, 15(6): 549-558.
13	POOPALASUNDARAM S, CHAMBERS D, GRAHAM A, et al. Serotonin receptor 1A (HTR1A), a novel regulator of GnRH neuronal migration in chick embryo[J]. Endocrinology, 2016, 157(12): 4632-4640.
14	MAHMOUDI F, HAGHIGHAT GOLLO K. Influences of serotonin hydrochloride on adiponectin, ghrelin and KiSS1 genes expression[J]. Galen Med J, 2020, 9: e1767.
15	BARBOSA M A, VERÍSSIMO L F, GERARDIN D C C, et al. Maternal exposure to fluoxetine during gestation and lactation does not alter plasma concentrations of testosterone, oestrogen or corticosterone in peripubertal offspring[J]. Reprod Fertil Dev, 2019, 31(5): 1002-1008.
16	SOGA T, TEO C H, CHAM K L, et al. Early-life social isolation impairs the gonadotropin-inhibitory hormone neuronal activity and serotonergic system in male rats[J]. Front Endocrinol (Lausanne), 2015, 6: 172.

[1]	XU Feixiang, WANG Sheng, XUE Mingming, TONG Chaoyang, CHEN Yumei. Effect of altered expression of long non-coding RNA-B230352I09 on proliferation and cycle of H9C2 cardiomyocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 578-582.
[2]	LIU Ziyang, WANG Xiaowen, CHEN Li. lncRNA GK-IT1 influences the carcinogenesis of non-small cell lung cancer cells through regulating aldolase A [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 591-601.
[3]	LI Tingting, PAN Yueping. Comparison of the central positioning ability of three single-file nickel-titanium instruments in simulated curved root canals [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 690-694.
[4]	LIN Yi. Current situation, problems and directions of high-risk pregnancy research in China [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(4): 403-408.
[5]	ZHANG Mi, LIU Shujun, LI Fubin, ZHANG Yan. Construction and evaluation of IgG antibody Fc combinational mutation library with mammalian cell surface display system [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(4): 510-517.
[6]	WU Yue, ZHANG Jiaying, WANG Wei, LI Jin. Classification and research progress of corneal neurotization [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(4): 528-534.
[7]	DU Yuting, ZHANG Jing, HUANG Ying, ZHANG Jing. Effect of ferroptosis on regeneration after muscle injury [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 298-306.
[8]	Ming CHEN, Jing ZHANG. Inhibitory effect of sanguinarine on proliferaton and invasion of gastric cancer cells by upregulating m⁶A methyltransferase 14 [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 135-141.
[9]	Qin GU, Yingqian XIA, Yiqing ZHU, Liying MA, Lei QU, Wenguang SUN. Analysis of the effects of individualized one-day outpatient diet guidance on glycemic control, body weight gain rate and pregnancy outcome in pregnant women with gestational diabetes mellitus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 185-191.
[10]	Wei CHEN, Yingbin LIU. Progress and controversy in comprehensive treatment of hilar cholangiocarcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 1-8.
[11]	Ye HE, Fang FANG. Relationship between preoperative glycosylated hemoglobin and postoperative delirium in patients following off-pump coronary artery bypass grafting [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 21-27.
[12]	Haicheng WANG, Yu LIU, Hui YE, Lin NI, Ying CAO, Yunlong SUN, Bing XIAO, Caixia MA, Lifang TANG. Molecular genetic diagnosis of 9 cases with 46,XY complete gonadal dysgenesis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 63-69.
[13]	Yi WU, Fang FANG, Hao HUANG, Ying CHEN. Influences of oral administration of probiotics on postoperative infection and liver function recovery in patients with partial hepatectomy [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 9-15.
[14]	Geng-feng JI, Zhi-bo ZHANG. Factors related to prognosis of portoenterostomy for type Ⅲ biliary atresia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(9): 1142-1146.
[15]	Yi-feng SHI, Ying-ru HUANG, Yun-xiao LIU, Song ZHANG, Hua XIAN. Effects of heat shock protein 70 on cytoactive of sciatic nerve cryopreservation and nerve regeneration after allograft [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(9): 1190-1196.