
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2023, Vol. 43 ›› Issue (10): 1236-1244.doi: 10.3969/j.issn.1674-8115.2023.10.003
• Basic research • Previous Articles
ZHANG Yirong1,2(
), WEI Weiqing2, MA Jiao2(
), ZHANG Xue1(
)
Received:2023-04-06
Accepted:2023-05-22
Online:2023-10-28
Published:2023-10-28
Contact:
MA Jiao,ZHANG Xue
E-mail:rongrongz@sjtu.edu.cn;drjiaoma@shsmu.edu.cn;xuezhang@shutcm.edu.cn
Supported by:CLC Number:
ZHANG Yirong, WEI Weiqing, MA Jiao, ZHANG Xue. Research on the role of SOX9 in regulating metabolic reprogramming in diffuse large B cell lymphoma[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(10): 1236-1244.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2023.10.003
| Gene | Forward primer (5'→3') | Reverse primer (5'→3') |
|---|---|---|
| NT5E | AAGGACTGATCGAGCCACTC | GGAAGTGTATCCAACGATTCCCA |
| EGFR | CCCACTCATGCTCTACAACCC | TCGCACTTCTTACACTTGCGG |
| VCAN | GTAACCCATGCGCTACATAAAGT | GGCAAAGTAGGCATCGTTGAAA |
| COL5A1 | GCCCGGATGTCGCTTACAG | AAATGCAGACGCAGGGTACAG |
| GPC1 | TGAAGCTGGTCTACTGTGCTC | CCCAGAACTTGTCGGTGATGA |
| CLDN3 | AACACCATTATCCGGGACTTCT | GCGGAGTAGACGACCTTGG |
| SDC1 | CTGCCGCAAATTGTGGCTAC | TGAGCCGGAGAAGTTGTCAGA |
| GPC3 | ATTGGCAAGTTATGTGCCCAT | TTCGGCTGGATAAGGTTTCTTC |
| GPC4 | GTGGGAAATGTGAACCTGGAA | CGAGGGACATCTCCGAAGG |
| PKP2 | ATGACATGCTAAAGGCTGGCA | GGGAGCTGTACTGTGCTGTTC |
Tab 1 Primers for glycolysis
| Gene | Forward primer (5'→3') | Reverse primer (5'→3') |
|---|---|---|
| NT5E | AAGGACTGATCGAGCCACTC | GGAAGTGTATCCAACGATTCCCA |
| EGFR | CCCACTCATGCTCTACAACCC | TCGCACTTCTTACACTTGCGG |
| VCAN | GTAACCCATGCGCTACATAAAGT | GGCAAAGTAGGCATCGTTGAAA |
| COL5A1 | GCCCGGATGTCGCTTACAG | AAATGCAGACGCAGGGTACAG |
| GPC1 | TGAAGCTGGTCTACTGTGCTC | CCCAGAACTTGTCGGTGATGA |
| CLDN3 | AACACCATTATCCGGGACTTCT | GCGGAGTAGACGACCTTGG |
| SDC1 | CTGCCGCAAATTGTGGCTAC | TGAGCCGGAGAAGTTGTCAGA |
| GPC3 | ATTGGCAAGTTATGTGCCCAT | TTCGGCTGGATAAGGTTTCTTC |
| GPC4 | GTGGGAAATGTGAACCTGGAA | CGAGGGACATCTCCGAAGG |
| PKP2 | ATGACATGCTAAAGGCTGGCA | GGGAGCTGTACTGTGCTGTTC |
| 1 | ROSENWALD A, WRIGHT G, CHAN W C, et al. The use of molecular profiling to predict survival after chemotherapy for diffuse large-B-cell lymphoma[J]. N Engl J Med, 2002, 346(25): 1937-1947. |
| 2 | BEA S. Diffuse large B-cell lymphoma subgroups have distinct genetic profiles that influence tumor biology and improve gene-expression-based survival prediction[J]. Blood, 2005, 106(9): 3183-3190. |
| 3 | PAVLOVA N N, ZHU J J, THOMPSON C B. The hallmarks of cancer metabolism: still emerging[J]. Cell Metab, 2022, 34(3): 355-377. |
| 4 | HANAHAN D, WEINBERG R A. Hallmarks of cancer: the next generation[J]. Cell, 2011, 144(5): 646-674. |
| 5 | CONDELLI V, CRISPO F, PIETRAFESA M, et al. HSP90 molecular chaperones, metabolic rewiring, and epigenetics: impact on tumor progression and perspective for anticancer therapy[J]. Cells, 2019, 8(6): 532. |
| 6 | SUN N Y, YANG M H. Metabolic reprogramming and epithelial-mesenchymal plasticity: opportunities and challenges for cancer therapy[J]. Front Oncol, 2020, 10: 792. |
| 7 | YIN G, LIANG Y, WANG Y, et al. mTOR complex 1 signalling regulates the balance between lipid synthesis and oxidation in hypoxia lymphocytes[J]. Biosci Rep, 2017, 37(1): BSR20160479. |
| 8 | KIRSCH B J, CHANG S J, BETENBAUGH M J, et al. Non-Hodgkin lymphoma metabolism[M]. Cham: Springer International Publishing, 2018. |
| 9 | PANDA M, TRIPATHI S K, BISWAL B K. SOX9: an emerging driving factor from cancer progression to drug resistance[J]. Biochim Biophys Acta Rev Cancer, 2021, 1875(2): 188517. |
| 10 | ENJUANES A, FERNÀNDEZ V, HERNÁNDEZ L, et al. Identification of methylated genes associated with aggressive clinicopathological features in mantle cell lymphoma[J]. PLoS One, 2011, 6(5): e19736. |
| 11 | BENNETT L B, SCHNABEL J L, KELCHEN J M, et al. DNA hypermethylation accompanied by transcriptional repression in follicular lymphoma[J]. Genes Chromosom Cancer, 2009, 48(9): 828-841. |
| 12 | CHENG P F, SHAKHOVA O, WIDMER D S, et al. Methylation-dependent SOX9 expression mediates invasion in human melanoma cells and is a negative prognostic factor in advanced melanoma[J]. Genome Biol, 2015, 16(1): 42. |
| 13 | PASSERON T, VALENCIA J C, NAMIKI T, et al. Upregulation of SOX9 inhibits the growth of human and mouse melanomas and restores their sensitivity to retinoic acid[J]. J Clin Invest, 2009, 119(4): 954-963. |
| 14 | PRÉVOSTEL C, RAMMAH-BOUAZZA C, TRAUCHESSEC H, et al. SOX9 is an atypical intestinal tumor suppressor controlling the oncogenic Wnt/ß-catenin signaling[J]. Oncotarget, 2016, 7(50): 82228-82243. |
| 15 | SLATTERY M L, HERRICK J S, MULLANY L E, et al. The co-regulatory networks of tumor suppressor genes, oncogenes, and miRNAs in colorectal cancer[J]. Genes Chromosom Cancer, 2017, 56(11): 769-787. |
| 16 | SCHMITZ R, WRIGHT G W, HUANG D W, et al. Genetics and pathogenesis of diffuse large B-cell lymphoma[J]. N Engl J Med, 2018, 378(15): 1396-1407. |
| 17 | LEICH E, SALAVERRIA I, BEA S, et al. Follicular lymphomas with and without translocation t(14;18) differ in gene expression profiles and genetic alterations[J]. Blood, 2009, 114(4): 826-834. |
| 18 | SOTIRIOU C, WIRAPATI P, LOI S, et al. Gene expression profiling in breast cancer: understanding the molecular basis of histologic grade to improve prognosis[J]. J Natl Cancer Inst, 2006, 98(4): 262-272. |
| 19 | REDDY A, ZHANG J, DAVIS N S, et al. Genetic and functional drivers of diffuse large B cell lymphoma[J]. Cell, 2017, 171(2): 481-494.e15. |
| 20 | SHAFFER A L, WRIGHT G, YANG L M, et al. A library of gene expression signatures to illuminate normal and pathological lymphoid biology[J]. Immunol Rev, 2006, 210: 67-85. |
| 21 | SUBRAMANIAN A, TAMAYO P, MOOTHA V K, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles[J]. Proc Natl Acad Sci USA, 2005, 102(43): 15545-15550. |
| 22 | YOSHIHARA K, SHAHMORADGOLI M, MARTÍNEZ E, et al. Inferring tumour purity and stromal and immune cell admixture from expression data[J]. Nat Commun, 2013, 4: 2612. |
| 23 | JIANG Y W, HATZI K, ELEMENTO O, et al. Enhancer profiling reveals SOX9 as a novel transcription regulator of B cell activation and DLBCL transformation[J]. Blood, 2012, 120(21): 527. |
| 24 | SHEN Y J, ZHOU J Q, NIE K, et al. Oncogenic role of the SOX9-DHCR24-cholesterol biosynthesis axis in IGH-BCL2+ diffuse large B-cell lymphomas[J]. Blood, 2022, 139(1): 73-86. |
| 25 | GOOPTU M, WHITAKER-MENEZES D, SPRANDIO J, et al. Mitochondrial and glycolytic metabolic compartmentalization in diffuse large B-cell lymphoma[J]. Semin Oncol, 2017, 44(3): 204-217. |
| 26 | LAM L T, WRIGHT G, DAVIS R E, et al. Cooperative signaling through the signal transducer and activator of transcription 3 and nuclear factor-κB pathways in subtypes of diffuse large B-cell lymphoma[J]. Blood, 2008, 111(7): 3701-3713. |
| 27 | JIANG Y W, HATZI K, SHAKNOVICH R. Mechanisms of epigenetic deregulation in lymphoid neoplasms[J]. Blood, 2013, 121(21): 4271-4279. |
| [1] | CHENG Ran, HU Jiajia, LI Biao. Advances in the application of 18F-FDG PET/CT radiomics for diagnosis, treatment and prognosis prediction of lymphoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 781-787. |
| [2] | LI Ying, TAN Yangxia, YIN Hongxin, JIANG Yanling, CHEN Li, MENG Guoyu. Research progress in the pathogenesis and prognosis of ZNF384 fusion subtype acute leukemia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 631-640. |
| [3] | HU Zeyu, ZHOU Cheng, YANG Lin, MA Xiaoyan, XIAO Haijuan, SI Hailong. Monomorphic epitheliotropic intestinal T-cell lymphoma: a case with recurrent gastrointestinal hemorrhage [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 132-136. |
| [4] | HU Zeyu, ZHOU Cheng, YANG Lin, MA Xiaoyan, XIAO Haijuan, SI Hailong. Monomorphic epitheliotropic intestinal T-cell lymphoma: a case with recurrent gastrointestinal hemorrhage [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, (): 1-5. |
| [5] | HU Jiacheng, ZHU Qian, WANG Jiaqi, WU Yingli, LEI Hu. Function of UCHL3 in maintaining the survival of FLT3-ITD positive acute myeloid leukemia cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(10): 1383-1393. |
| [6] | DING He, CAO Yanglin, HE Yang, WEI Xing, YANG Jianfeng. SMAD7 expression in multiple myeloma and its effect on cell proliferation and drug resistance [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 858-865. |
| [7] | Yanyan LIN, Yan XU, Hui LI. Progress in research on the mechanism of drug resistance to conventional chemotherapeutic drugs in children with acute lymphoblastic leukemia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 211-217. |
| [8] | Qing LIU, Na ZHANG, Jing-bo SHAO, Hong LI, Kai CHEN, Cheng-kan DU, Zhen WANG, Hui JIANG. Clinical characteristics and prognosis of pediatric acute leukemia patients with MLL gene rearrangements [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 903-909. |
| [9] | Chen CHEN, Feng-hou GAO. Degradation of BCR-ABL fusion protein in chronic myeloid leukemia cells induced by isoalantolactone [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 891-897. |
| [10] | Jia-shi ZHU, Hong LI, Jing-bo SHAO, Na ZHANG, Jing-wei YANG, Kai CHEN, Zhen WANG, Hui JIANG. A clinical study on treatment failure of childhood acute lymphoblastic leukemia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 764-769. |
| [11] | Wei HE, Yong ZUO. Effect of oridonin up-regulating PLK1 on the cell cycle of Jurkat cells [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(5): 603-611. |
| [12] | Ling-ling LI, Qian LI, Ming-yu LI, Zheng LIU, Qian-cheng SHEN. Analysis of tumor immune-related differentially expressed genes in adults and children with acute myeloid leukemia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(5): 579-587. |
| [13] | Ren-yan WU, Xiao-lin GUO, Deng-li HONG, Lei CHEN. Identification of potential therapeutic target genes in pediatric acute leukemia of ambiguous lineage based on bioinformatics analysis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(3): 320-327. |
| [14] | Gao-yang LI, Ji-feng JIANG, Chuan-xu LIU, Wen-hao ZHANG, Yang ZHU, Yu-jie MA, Rong TAO. A pilot study on the efficacy and safety of anlotinib in the treatment of refractory natural killer/T-cell lymphoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(2): 196-201. |
| [15] | DONG Xin-yi1, FAN Qiu-yue1, QIU Shu-han1, ZHOU Jia-yao1, LU Ying2. Clinical application of receptor tyrosine kinase inhibitors to acute myeloid leukemia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(12): 1665-1671. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||