Generation and validation of the conditional osteoblast-specific retinoic acid signaling inhibition mouse model

doi:10.3969/j.issn.1674-8115.2024.06.002

Journal of Shanghai Jiao Tong University (Medical Science) ›› 2024, Vol. 44 ›› Issue (6): 676-686.doi: 10.3969/j.issn.1674-8115.2024.06.002

• Oral and Cranio-maxillofacial Science • Previous Articles Next Articles

Generation and validation of the conditional osteoblast-specific retinoic acid signaling inhibition mouse model

SUN Siyuan¹^,²(), LIU Yuanqi¹^,²(), CUI Yiwen¹^,², HUANG Zihan¹^,², MEI Li²^,³, DAI Qinggang⁴, JIANG Lingyong¹^,²()

^1.Department of Oral and Maxillofacial Surgery, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine; College of Stomatology, Shanghai Jiao Tong University; National Center for Stomatology; National Clinical Research Center for Oral Diseases; Shanghai Key Laboratory of Stomatology; Shanghai Research Institute of Stomatology, Shanghai 200011, China
^2.Shanghai -New Zealand Joint Laboratory of Dentistry, Centre for Clinical and Fundamental Craniofacial Research, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, China
^3.Department of Oral Sciences, Faculty of Dentistry, University of Otago, Dunedin 9016, New Zealand
^4.Department of 2nd Dental Centre, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine; College of Stomatology, Shanghai Jiao Tong University; National Center for Stomatology; National Clinical Research Center for Oral Diseases; Shanghai Key Laboratory of Stomatology; Shanghai Research Institute of Stomatology, Shanghai 200011, China

Received:2024-02-01 Accepted:2024-03-21 Online:2024-06-28 Published:2024-06-28
Contact: JIANG Lingyong E-mail:ssy1412832053@163.com;liuyuanqi@sjtu.edu.cn;jianglingyong@sjtu.edu.cn
Supported by:
“Two-Hundred Talents” Program of Shanghai Jiao Tong University School of Medicine(20221809);Fundamental Research Funds for the Central Universities(YG2023ZD14);National Natural Science Foundation of China(82071083);Natural Science Foundation of Shanghai(21ZR1436900);Hainan Provincial Natural Science Foundation(824MS152);Shanghai Science and Technology Innovation Action Plan-International Science and Technology Cooperation Program(23410713600);Cross-Disciplinary Research Fund of Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine(JYJC202116);Biomaterials and Regenerative Medicine Institute Cooperative Research Project, Shanghai Jiao Tong University School of Medicine(2022LHB02);Original Exploration Project of Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine(JYYC003)

Abstract

Abstract:

Objective ·To construct and verify the mouse model that can mimic the vitamin A deficiency (VAD)-like craniofacial skeletal deformity and do not cause embryonic death. Methods ·Based on the Cre-LoxP system, the Osx^Cre;Rosa26^dn/dn mice expressing osteoblast-specific dominant-negative retinoid acid receptor α (dnRARα) mutation were obtained by hybridization through Osx^Cre and Rosa26^{dnRARα/dnRARα} mice, to achieve the conditional inhibition of retinoic acid signaling to simulate VAD disease. Femur bone mesenchymal stem cells (BMSCs) and parietal bone cells of Osx^Cre;Rosa26^dn/dn mice and their control littermates were isolated and underwent osteogenic induction, to assess the expression of retinoid acid receptor α (RARα) protein through Western blotting. Osteoblasts induced from parietal bone cells of Osx^Cre;Rosa26^dn/dn mice and their control littermates were isolated and the effect of retinoic acid signaling inhibition was verified through dual luciferase gene reporter assay. Meanwhile, Ad-eGFP or Ad-Cre adenovirus-infected femur BMSCs and parietal bone cells of Rosa26^dn/dn mice underwent osteogenic induction to assess the expression of dominant-negative mutant protein and the inhibition of the retinoic acid signaling pathway in vitro by Western blotting and dual luciferase gene reporter assay. Moreover, the skulls of 6-week-old Osx^Cre;Rosa26^dn/dn mice were collected, and Micro-CT scanning and three-dimensional (3D) reconstruction were performed to verify the craniofacial skeletal deformities of the mouse model. Results ·Western blotting results demonstrated that the level of RARα protein increased in the femur and parietal osteoblasts of Osx^Cre;Rosa26^dn/dn mice compared to that of their control littermates, and also increased in the Ad-Cre-infected femur and parietal osteoblasts of Rosa26^dn/dn mice compared to that in the Ad-eGFP-infected group (P<0.05). Dual luciferase gene reporter assay results indicated that the activity of retinoid acid response element (RARE) was inhibited in the osteoblasts of Osx^Cre;Rosa26^dn/dn mice compared to their control littermates, and was also inhibited in the Ad-Cre-infected group compared to the Ad-eGFP-infected group (P<0.05). Micro-CT and 3D reconstruction suggested that the skull of 6-week-old Osx^Cre;Rosa26^dn/dn mice exhibited VAD-like craniofacial skeletal deformities, including smaller size of the skull and osteogenesis imperfecta compared to their control littermates. Conclusion ·An osteoblast-specific dnRARα expressing mouse model that can mimic VAD-like craniofacial skeletal deformity is successfully constructed, therefore providing a new model for exploring the pathogenesis and therapeutic targets of VAD-like craniofacial skeletal deformity in the future.

Key words: vitamin A deficiency (VAD), craniofacial skeletal deformity, osteoblast, conditional dominant-negative mutant expressing mice, retinoic acid receptor (RAR)

CLC Number:

SUN Siyuan, LIU Yuanqi, CUI Yiwen, HUANG Zihan, MEI Li, DAI Qinggang, JIANG Lingyong. Generation and validation of the conditional osteoblast-specific retinoic acid signaling inhibition mouse model[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(6): 676-686.

Figures/Tables 6

Tab 1 PCR primers for mouse genotyping

Primer name	Forward (5′→3′)	Reverse (5′→3′)
dnRARα-mut	ATGGTGTACACGTGTCACC	CACCTTCTCAATGAGCTCC
dnRARα-wt	CCAAAGTCGCTCTGAGTTGTTATC	GAGCGGGAGAAATGGATATG
OsxCre	TGCCACGACCAAGTGACAGCAATG	ACCAGAGACGGAAATCCATCGCTC

Fig 1 Schematic diagram of conditional dnRARα gene expressing by Cre-LoxP system

Fig 2 Mouse hybridization and genotyping

Fig 3 Verification of the inhibition of osteoblastic retinoic acid signaling in OsxCre;Rosa26dn/dn mice

Fig 4 Verification of the inhibition of osteoblastic retinoic acid signaling by Cre-LoxP system in vitro

Fig 5 Craniofacial skeletal deformity analysis of OsxCre;Rosa26dn/dn mice

TrendMD

References 35

1	TIERNEY M T, POLAK L, YANG Y H, et al. Vitamin A resolves lineage plasticity to orchestrate stem cell lineage choices[J]. Science, 2024, 383(6687): eadi7342.
2	SEUFERT J, KRISHNAN N, DARMSTADT G L, et al. Subnational estimates of vitamin A supplementation coverage in children: a geospatial analysis of 45 low- and middle-income countries[J]. Public Health, 2024, 228: 194-199.
3	O'CONNOR E A, EVANS C V, IVLEV I, et al. Vitamin and mineral supplements for the primary prevention of cardiovascular disease and cancer: updated evidence report and systematic review for the US preventive services task force[J]. JAMA, 2022, 327(23): 2334-2347.
4	CHAKRABORTY U, CHANDRA A. Bitot's spots, dry eyes, and night blindness indicate vitamin A deficiency[J]. Lancet, 2021, 397(10270): e2.
5	SHEFTEL J, VAN STUIJVENBERG M E, DHANSAY M A, et al. Chronic and acute hypervitaminosis A are associated with suboptimal anthropometric measurements in a cohort of South African preschool children[J]. Am J Clin Nutr, 2022, 115(4): 1059-1068.
6	GHYSELINCK N B, DUESTER G. Retinoic acid signaling pathways[J]. Development, 2019, 146(13): dev167502.
7	LOHNES D, MARK M, MENDELSOHN C, et al. Function of the retinoic acid receptors (RARs) during development (Ⅰ). Craniofacial and skeletal abnormalities in RAR double mutants[J]. Development, 1994, 120(10): 2723-2748.
8	ONO K, SANDELL L L, TRAINOR P A, et al. Retinoic acid synthesis and autoregulation mediate zonal patterning of vestibular organs and inner ear morphogenesis[J]. Development, 2020, 147(15): dev192070.
9	ABADIE R B, STAPLES A A, LAUCK L V, et al. Vitamin A-mediated birth defects: a narrative review[J]. Cureus, 2023, 15(12): e50513.
10	DAMM K, HEYMAN R A, UMESONO K, et al. Functional inhibition of retinoic acid response by dominant negative retinoic acid receptor mutants[J]. Proc Natl Acad Sci U S A, 1993, 90(7): 2989-2993.
11	CUNNINGHAM C J, CHOI R B, BULLOCK W A, et al. Perspective: the current state of Cre driver mouse lines in skeletal research—challenges and opportunities[J]. Bone, 2023, 170: 116719.
12	GEMBERLING M P, SIKLENKA K, RODRIGUEZ E, et al. Transgenic mice for in vivo epigenome editing with CRISPR-based systems[J]. Nat Methods, 2021, 18(8): 965-974.
13	ROSSELOT C, SPRAGGON L, CHIA I, et al. Non-cell-autonomous retinoid signaling is crucial for renal development[J]. Development, 2010, 137(2): 283-292.
14	DAI Q, SUN S, JIN A, et al. Osteoblastic RAR inhibition causes VAD-like craniofacial skeletal deformity[J]. J Dent Res, 2023, 102(6): 667-677.
15	VICTORA C G, CHRISTIAN P, VIDALETTI L P, et al. Revisiting maternal and child undernutrition in low-income and middle-income countries: variable progress towards an unfinished agenda[J]. Lancet, 2021, 397(10282): 1388-1399.
16	NUREDIN A, MELIS T, ABDU A O. Clinical vitamin A deficiency among preschool aged children in Southwest Ethiopia[J]. Front Nutr, 2024, 11: 1267979.
17	SCHMIDT M J, STEENKAMP G, CALDWELL P, et al. Radiographic analysis of the thickness of the cranial bones in captive compared to wild-living cheetahs and in cheetahs with hypovitaminosis A[J]. PLoS One, 2021, 16(8): e0255924.
18	WANG F P, TANG Y W, CAI Y J, et al. Intrafollicular retinoic acid signaling is important for luteinizing hormone-induced oocyte meiotic resumption[J]. Genes, 2023, 14(4): 946.
19	BAYBUTT R C, STANDARD J T, DIM D, et al. Cod liver oil, but not retinoic acid, treatment restores bone thickness in a vitamin A-deficient rat[J]. Nutrients, 2022, 14(3): 486.
20	PETRELLI B, BENDELAC L, HICKS G G, et al. Insights into retinoic acid deficiency and the induction of craniofacial malformations and microcephaly in fetal alcohol spectrum disorder[J]. Genesis, 2019, 57(1): e23278.
21	FIRSCHEIN H E. Collagen and mineral accretion rates in bone during vitamin A deficiency[J]. Am J Physiol, 1970, 219(5): 1183-1187.
22	KNAPIK J J, HOEDEBECKE S S. Vitamin A and bone fractures: systematic review and meta-analysis[J]. J Spec Oper Med, 2021, 21(2): 100-107.
23	TIMBERLAKE A T, MCGEE S, ALLINGTON G, et al. De novo variants implicate chromatin modification, transcriptional regulation, and retinoic acid signaling in syndromic craniosynostosis[J]. Am J Hum Genet, 2023, 110(5): 846-862.
24	LAMMER E J, CHEN D T, HOAR R M, et al. Retinoic acid embryopathy[J]. N Engl J Med, 1985, 313(14): 837-841.
25	WU Y, KUROSAKA H, WANG Q, et al. Retinoic acid deficiency underlies the etiology of midfacial defects[J]. J Dent Res, 2022, 101(6): 686-694.
26	LOKKEN-TOYLI K L, DIAZ-OCHOA V E, CAMACHO L, et al. Vitamin A deficiency impairs neutrophil-mediated control of Salmonella via SLC11A1 in mice[J]. Nat Microbiol, 2024, 9(3): 727-736.
27	YU H R, WU J, LI K X, et al. Integrated analysis of murine cornea identifies JAK/STAT signaling pathway upregulated specifically in female vitamin A deficient mice[J]. Exp Eye Res, 2023, 237: 109714.
28	RADHAKRISHNAN R, LEUNG M, ROEHRICH H, et al. Mice lacking the systemic vitamin A receptor RBPR2 show decreased ocular retinoids and loss of visual function[J]. Nutrients, 2022, 14(12): 2371.
29	CHIU M, WATSON S. Xerophthalmia and vitamin A deficiency in an autistic child with a restricted diet[J]. BMJ Case Rep, 2015, 2015: bcr2015209413.
30	CHEN J Q, SHI Y, REGAN J, et al. Osx-Cre targets multiple cell types besides osteoblast lineage in postnatal mice[J]. PLoS One, 2014, 9(1): e85161.
31	BOK S, YALLOWITZ A R, SUN J, et al. A multi-stem cell basis for craniosynostosis and calvarial mineralization[J]. Nature, 2023, 621(7980): 804-812.
32	YEE M M F, CHIN K Y, IMA-NIRWANA S, et al. Vitamin A and bone health: a review on current evidence[J]. Molecules, 2021, 26(6): 1757.
33	LI Q W, XU R S, LEI K X, et al. Insights into skeletal stem cells[J]. Bone Res, 2022, 10(1): 61.
34	SUN J, HU L L, BOK S, et al. A vertebral skeletal stem cell lineage driving metastasis[J]. Nature, 2023, 621(7979): 602-609.
35	COLLINS M T, MARCUCCI G, ANDERS H J, et al. Skeletal and extraskeletal disorders of biomineralization[J]. Nat Rev Endocrinol, 2022, 18(8): 473-489.

[1]	ZHANG Yi-jing1, 2, XU Jian1, 2. Effect of maternal vitamin A deficiency during pregnancy on neurodevelopment of offspring [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1277-1282.
[2]	YU Wei, ZHU Chao, MAO Wei-wei, ZHAO En-dian, MENG Sheng-wei, JIANG Sheng-dan . Effect of neuropeptide substance P on proliferation of murine osteoblasts through induction of RUNX2 expression [J]. , 2017, 37(1): 15-.
[3]	CHEN Xiao-jing, HU Yan, ZHANG Shuang, et al. Emodin promotes differentiation of preosteoblast via BMP-9 signaling pathway [J]. , 2014, 34(6): 781-.
[4]	WANG Ying, YANG Yun-mei. Research and application of target therapy for osteoporosis [J]. , 2012, 32(8): 1101-.
[5]	WANG Luo-wen, DENG Lian-fu, ZHU Ya-ping, et al. Regulation of interaction of osteoblasts and osteoclasts by hypoxia/hypoxia-inducible factor-1&alpha\|pathway [J]. , 2012, 32(3): 274-.
[6]	ZUO Chi-jian, LA Ting, ZHANG Ning, et al. Regulation of expression of osteoblast transcription factor SATB2 by BMP2 in osteoblastic differentiation of MSCs [J]. , 2011, 31(12): 1661-.
[7]	WANG Yong-ping, OUYANG Yuan-ming, JIANG Yao. Research progress of regulation of osteoblast differentiation and proliferation [J]. , 2011, 31(10): 1465-.
[8]	SUN Ming-shu, GUO Yong-ping, GU Le-yi, et al. Effect of bone morphogenetic protein 2 siRNA targeted suppression on osteogenic differentiation and calcification of human umbilical arterial smooth muscle cells cultured in vitro [J]. , 2010, 30(11): 1329-.
[9]	CUI Lun, WANG Jun, QI Jin, et al. Effects of hypoxia on expression of Cyr61/CCN1 in murine osteoblasts [J]. , 2009, 29(8): 909-.

Generation and validation of the conditional osteoblast-specific retinoic acid signaling inhibition mouse model

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 6

TrendMD

References 35

Related Articles 9

Recommended Articles

Metrics

Comments