Regulatory effect of FGF2 on the expression of R-spondin 1 in mouse intestinal stromal cells

doi:10.3969/j.issn.1674-8115.2025.08.001

Abstract

Abstract:

Objective ·To preliminarily investigate the regulatory effect and underlying mechanism of fibroblast growth factor 2 (FGF2) on R-spondin 1 (Rspo1) expression in CD34⁺CD81⁺ stromal cells from the mouse colon. Methods ·Colonic CD45^-CD326^-CD31^-GP38⁺CD81⁺Rspo1-tdTomato⁺ stromal cells were sorted from Rspo1-tdTomato reporter mice by flow cytometry and subsequently cultured in vitro. The expression of surface protein markers was evaluated by flow cytometry after 14 d of culture. qPCR was employed to quantify Rspo1 expression in response to stimulation with FGF2, FGF9, epidermal growth factor (EGF), platelet-derived growth factor-bb (PDGF-bb), insulin-like growth factor 1 (IGF1), or hepatocyte growth factor (HGF). RNA sequencing and bioinformatic analyses were used to identify the signaling pathways underlying FGF2-mediated regulation of Rspo1, followed by preliminary validation with pathway-specific inhibitors and qPCR. Results ·After 14 d of culture, the sorted colonic stromal cells retained expression of CD34, CD81, and glycoprotein GP38, while remaining negative for other lineages markers CD45, CD326, and CD31. qPCR revealed that 20 ng/mL FGF2 significantly suppressed Rspo1 expression, whereas the other tested growth factors exerted no notable effect. RNA sequencing and bioinformatic analysis indicated that mitogen-activated protein kinase (MAPK) signaling pathway played a key role in the regulatory effect of FGF2 on Rspo1. qPCR further demonstrated that pretreatment with U0126, an inhibitor of mitogen extracellular kinase 1/2 (MEK1/2), reversed FGF2-mediated suppression of Rspo1 expression. Conclusion ·FGF2 may inhibit Rspo1 expression in mouse colonic CD34⁺CD81⁺ stromal cells via the MEK1/2-extracellular regulated protein kinase 1/2 (ERK1/2) signaling pathway.

Key words: R-spondin 1 gene, fibroblast growth factor 2 (FGF2), CD34⁺CD81⁺ stromal cell, mitogen-activated protein kinase (MAPK) pathway

CLC Number:

R392.9

LI Jingcong, ZHAO Han, LIN Qiaowen, SUN Hongxiang, SU Bing, WU Ningbo. Regulatory effect of FGF2 on the expression of R-spondin 1 in mouse intestinal stromal cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(8): 939-948.

Figures/Tables 6

Tab 1 Primer sequences for PCR

Primer name	Sequence (5'→3')
Hprt-F	TCCTCCTCAGACCGCTTTT
Hprt-R	CCTGGTTCATCATCGCTAATC
Rspo1-F	GGGATCAAGGGCAAGAGACAG
Rspo1-R	CTGGCGGATGTCGTTCCTC

Fig 1 Establishment and flow cytometry validation of CD34+CD81+ intestinal stromal cell culture system

Fig 2 Inhibitory effect of FBS on Rspo1 expression in CD34+CD81+ stromal cells

Fig 3 Inhibitory effect of FGF2 on the expression of Rspo1 in CD34+CD81+ stromal cells

Fig 4 FGF2 inhibits the expression of Rspo1 through MAPK signaling pathway in CD34+CD81+ stromal cells

Fig 5 Schematic diagram of the molecular mechanism by which FGF2 inhibits the expression of Rspo1 in CD34+CD81+ stromal cells

TrendMD

References 33

[1]	BARKER N, VAN ES J H, KUIPERS J, et al. Identification of stem cells in small intestine and colon by marker gene Lgr5[J]. Nature, 2007, 449: 1003-1007.
[2]	METCALFE C, KLJAVIN N M, YBARRA R, et al. Lgr5 ⁺ stem cells are indispensable for radiation-induced intestinal regeneration[J]. Cell Stem Cell, 2014, 14(2): 149-159.
[3]	VAN DER FLIER L G, CLEVERS H. Stem cells, self-renewal, and differentiation in the intestinal epithelium[J]. Annu Rev Physiol, 2009, 71: 241-260.
[4]	QI Z, CHEN Y G. Regulation of intestinal stem cell fate specification[J]. Sci China Life Sci, 2015, 58(6): 570-578.
[5]	PINTO D, GREGORIEFF A, BEGTHEL H, et al. Canonical Wnt signals are essential for homeostasis of the intestinal epithelium[J]. Genes Dev, 2003, 17(14): 1709-1713.
[6]	DEGIRMENCI B, VALENTA T, DIMITRIEVA S, et al. GLI1-expressing mesenchymal cells form the essential Wnt-secreting niche for colon stem cells[J]. Nature, 2018, 558(7710): 449-453.
[7]	AOKI R, SHOSHKES-CARMEL M, GAO N, et al. Foxl1-expressing mesenchymal cells constitute the intestinal stem cell niche[J]. Cell Mol Gastroenterol Hepatol, 2016, 2(2): 175-188.
[8]	STZEPOURGINSKI I, NIGRO G, JACOB J M, et al. CD34⁺ mesenchymal cells are a major component of the intestinal stem cells niche at homeostasis and after injury[J]. Proc Natl Acad Sci USA, 2017, 114(4): E506-E513.
[9]	WU N B, SUN H X, ZHAO X Y, et al. MAP3K2-regulated intestinal stromal cells define a distinct stem cell niche[J]. Nature, 2021, 592(7855): 606-610.
[10]	NIEHRS C, SEIDL C, LEE H. An "R-spondin code" for multimodal signaling ON-OFF states[J]. Bioessays, 2024, 46(10): e2400144.
[11]	DE LAU W, PENG W C, GROS P, et al. The R-spondin/Lgr5/Rnf43 module: regulator of Wnt signal strength[J]. Genes Dev, 2014, 28(4): 305-316.
[12]	HOLZEM M, BOUTROS M, HOLSTEIN T W. The origin and evolution of Wnt signalling[J]. Nat Rev Genet, 2024, 25(7): 500-512.
[13]	KIM K A, KAKITANI M, ZHAO J, et al. Mitogenic influence of human R-spondin1 on the intestinal epithelium[J]. Science, 2005, 309(5738): 1256-1259.
[14]	BORRELLI C, VALENTA T, HANDLER K, et al. Differential regulation of β-catenin-mediated transcription via N- and C-terminal co-factors governs identity of murine intestinal epithelial stem cells[J]. Nat Commun, 2021, 12(1): 1368.
[15]	SATO T, VRIES R G, SNIPPERT H J, et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche[J]. Nature, 2009, 459(7244): 262-265.
[16]	KOO B K, SPIT M, JORDENS I, et al. Tumour suppressor RNF43 is a stem-cell E3 ligase that induces endocytosis of Wnt receptors[J]. Nature, 2012, 488(7413): 665-669.
[17]	ZHOU X L, GENG L Y, WANG D G, et al. R-Spondin1/LGR5 activates TGFβ signaling and suppresses colon cancer metastasis[J]. Cancer Res, 2017, 77(23): 6589-6602.
[18]	LÄHDE M, HEINO S, HÖGSTRÖM J, et al. Expression of R-spondin 1 in Apc ^Min/+ mice suppresses growth of intestinal adenomas by altering Wnt and transforming growth factor beta signaling[J]. Gastroenterology, 2021, 160(1): 245-259.
[19]	ZHAO X Y, LI L, SUN H X, et al. A novel reporter mouse line for studying alveolar macrophages[J]. Sci China Life Sci, 2023, 66(11): 2527-2542.
[20]	CHIEREGATO K, CASTEGNARO S, MADEO D, et al. Epidermal growth factor, basic fibroblast growth factor and platelet-derived growth factor-bb can substitute for fetal bovine serum and compete with human platelet-rich plasma in the ex vivo expansion of mesenchymal stromal cells derived from adipose tissue[J]. Cytotherapy, 2011, 13(8): 933-943.
[21]	SUBIRAN C, KRISTENSEN S G, ANDERSEN C Y. Umbilical cord blood-derived platelet-rich plasma: a clinically acceptable substitute for fetal bovine serum?[J]. Fertil Steril, 2021, 115(2): 336-337.
[22]	GUIOTTO M, RAFFOUL W, HART A M, et al. Human platelet lysate to substitute fetal bovine serum in hMSC expansion for translational applications: a systematic review[J]. J Transl Med, 2020, 18(1): 351.
[23]	MOSSAHEBI-MOHAMMADI M, QUAN M Y, ZHANG J S, et al. FGF signaling pathway: a key regulator of stem cell pluripotency[J]. Front Cell Dev Biol, 2020, 8: 79.
[24]	ORNITZ D M, ITOH N. The fibroblast growth factor signaling pathway[J]. Wiley Interdiscip Rev Dev Biol, 2015, 4(3): 215-266.
[25]	CRAENMEHR M C, VAN DER KEUR C, ANHOLTS J H, et al. Effect of seminal plasma on dendritic cell differentiation in vitro depends on the serum source in the culture medium[J]. J Reprod Immunol, 2020, 137: 103076.
[26]	HEGER J I, FROEHLICH K, PASTUSCHEK J, et al. Human serum alters cell culture behavior and improves spheroid formation in comparison to fetal bovine serum[J]. Exp Cell Res, 2018, 365(1): 57-65.
[27]	BEENKEN A, MOHAMMADI M. The FGF family: biology, pathophysiology and therapy[J]. Nat Rev Drug Discov, 2009, 8(3): 235-253.
[28]	MATSUURA M, OKAZAKI K, NISHIO A, et al. Therapeutic effects of rectal administration of basic fibroblast growth factor on experimental murine colitis[J]. Gastroenterology, 2005, 128(4): 975-986.
[29]	SONG X Y, DAI D, HE X, et al. Growth factor FGF2 cooperates with interleukin-17 to repair intestinal epithelial damage[J]. Immunity, 2015, 43(3): 488-501.
[30]	XIE Y L, SU N, YANG J, et al. FGF/FGFR signaling in health and disease[J]. Signal Transduct Target Ther, 2020, 5(1): 181.
[31]	LIVINGSTON M J, SHU S Q, FAN Y, et al. Tubular cells produce FGF2 via autophagy after acute kidney injury leading to fibroblast activation and renal fibrosis[J]. Autophagy, 2023, 19(1): 256-277.
[32]	NICOLI S, DE SENA G, PRESTA M. Fibroblast growth factor 2-induced angiogenesis in zebrafish: the zebrafish yolk membrane (ZFYM) angiogenesis assay[J]. J Cell Mol Med, 2009, 13(8b): 2061-2068.
[33]	DIGNASS A U, TSUNEKAWA S, PODOLSKY D K. Fibroblast growth factors modulate intestinal epithelial cell growth and migration[J]. Gastroenterology, 1994, 106(5): 1254-1262.