Protective effect of apocynin on periodontitis-induced cognitive impairment in mice

doi:10.3969/j.issn.1674-8115.2026.05.005

Abstract

Abstract:

Objective ·To investigate the effect of apocynin (APO) on periodontitis-induced cognitive impairment in mice and its underlying mechanism. Methods ·C57BL/6 mice were used. A periodontitis model was established by injecting Porphyromonas gingivalis lipopolysaccharide (P.g LPS) into the palatal gingival sulcus of the maxillary first molars twice a week for four weeks. Apocynin was administered intraperitoneally as an intervention. Micro-computed tomography (Micro-CT) was used to observe alveolar bone resorption. The open field test and the Morris water maze were employed to assess cognitive function. Evans blue staining was used to detect blood-brain barrier permeability. Real-time qPCR was used to detect the mRNA expression levels of tight junction proteins zonula occludens-1 (Zo-1) and occludin (Occl), as well as interleukin-1β (Il-1β) and interleukin-8 (Il-8) in brains. Results ·Compared with the P.g LPS group, mice in the P.g LPS plus apocynin group showed significantly increased bone volume fraction (BV/TV) and bone mineral density (BMD), and a significantly decreased bone surface/bone volume ratio (BS/BV). In the open field test, there were no significant differences in locomotor activity among the four groups. In the Morris water maze, the latency of the P.g LPS plus apocynin group was significantly shorter than that of the P.g LPS group from day 3 during the navigation phase. In the probe test, the P.g LPS plus apocynin group crossed the target platform significantly more times than the P.g LPS group. Evans blue staining indicated that the absorbance values decreased significantly in the P.g LPS plus apocynin group. Compared with the P.g LPS group, the expression of Zo-1 (P=0.024) and Ocln (P=0.014) was upregulated, while Il-1β (P=0.001) and Il-8 (P=0.002) were downregulated in the brains of mice treated with apocynin. Conclusion ·Apocynin can alleviate periodontitis-induced cognitive impairment by inhibiting P.g LPS-induced inflammation, reducing alveolar bone resorption, and decreasing blood-brain barrier permeability. These findings suggest that apocynin may have potential neuroprotective effects, which provides an experimental basis for the treatment of periodontitis-related cognitive impairment.

Key words: apocynin, periodontitis, cognitive impairment, blood-brain barrier

CLC Number:

R781.4

Li Teng, Xu Lina, Jiang Yiting, He Zhiyan, Song Zhongchen, Zhou Wei. Protective effect of apocynin on periodontitis-induced cognitive impairment in mice[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(5): 594-601.

Figures/Tables 8

Tab 1 Primer sequences for PCR （5′→3′）

Gene	Forward sequence	Reverse sequence
Gapdh	ACAGTCCATGCCATCACTGCC	GCCTGCTTCACCACCTTCTTG
Il-1β	AAATCTCGCAGCAGCACATCAA	CCACGGGAAAGACACAGGTAGC
Il-8	CATTAATATTTAACGATGTGGATGCG	GCCTACCATCTTTAAACTGCACAAT
Zo-1	GTTGGCGACCTTGTGGATCT	TAGGAGGCAGGCTTTTGACG
Ocln	CATACCCTTGGTCGCGCTTA	CCAGGCATCCAACAAACTGC

Fig 1 Effects of apocynin on alveolar bone in mice

Fig 2 Effects of apocynin on locomotor activity in mice

Fig 3 Effects of apocynin on spatial learning ability in mice

Fig 4 Effects of APO on spatial memory in mice

Fig 5 Effects of APO on the mRNA expression of inflammatory factors in the spleen of mice

Fig 6 Effects of APO on the mRNA expression of inflammatory factors in the hippocampus of mice

Fig 7 Effect of APO on the permeability and integrity of the blood-brain barrier in mice

TrendMD

References 23

[1]	Slots J. Periodontitis: facts, fallacies and the future[J]. Periodontol 2000, 2017, 75(1): 7-23.
[2]	Hajishengallis G. Interconnection of periodontal disease and comorbidities: evidence, mechanisms, and implications[J]. Periodontol 2000, 2022, 89(1): 9-18.
[3]	Villar A, Paladini S, Cossatis J. Periodontal disease and Alzheimer′s: insights from a systematic literature network analysis[J]. J Prev Alzheimers Dis, 2024, 11(4): 1148-1165.
[4]	Scheltens P, de Strooper B, Kivipelto M, et al. Alzheimer′s disease[J]. Lancet, 2021, 397(10284): 1577-1590.
[5]	Tolosa E, Garrido A, Scholz S W, et al. Challenges in the diagnosis of Parkinson′s disease[J]. Lancet Neurol, 2021, 20(5): 385-397.
[6]	Liccardo D, Marzano F, Carraturo F, et al. Potential bidirectional relationship between periodontitis and Alzheimer′s disease[J]. Front Physiol, 2020, 11: 683.
[7]	Kanimozhi, Aishwarya K, Yadav S, et al. Exploring the link between periodontal disease and systemic conditions: implications for Alzheimer′s, Parkinson′s, and rheumatoid arthritis[J]. J Pharm Bioallied Sci, 2024, 16(Suppl 4): S3775-S3777.
[8]	Li R H, Wang J N, Xiong W, et al. The oral-brain axis: can periodontal pathogens trigger the onset and progression of Alzheimer′s disease?[J]. Front Microbiol, 2024, 15: 1358179.
[9]	de Diego-Otero Y, El Bekay R, García-Guirado F, et al. Apocynin, a selective NADPH oxidase (Nox2) inhibitor, ameliorates behavioural and learning deficits in the fragile X syndrome mouse model[J]. Biomedicines, 2024, 12(12): 2887.
[10]	Hou L Y, Sun F Q, Huang R X, et al. Inhibition of NADPH oxidase by apocynin prevents learning and memory deficits in a mouse Parkinson′s disease model[J]. Redox Biol, 2019, 22: 101134.
[11]	Joseph E, Villalobos-Acosta D M Á, Torres-Ramos M A, et al. Neuroprotective effects of apocynin and galantamine during the chronic administration of scopolamine in an Alzheimer′s disease model[J]. J Mol Neurosci, 2020, 70(2): 180-193.
[12]	Jungbauer G, Stähli A, Zhu X L, et al. Periodontal microorganisms and Alzheimer disease: a causative relationship?[J]. Periodontol 2000, 2022, 89(1): 59-82.
[13]	Cichońska D, Mazuś M, Kusiak A. Recent aspects of periodontitis and Alzheimer′s disease: a narrative review[J]. Int J Mol Sci, 2024, 25(5): 2612.
[14]	Lei S, Li J, Yu J J, et al. Porphyromonas gingivalis bacteremia increases the permeability of the blood-brain barrier via the Mfsd2a/Caveolin-1 mediated transcytosis pathway[J]. Int J Oral Sci, 2023, 15(1): 3.
[15]	Qian X S, Lin X X, Hu W Q, et al. Intestinal homeostasis disrupted by periodontitis exacerbates Alzheimer′s Disease in APP/PS1 mice[J]. J Neuroinflammation, 2024, 21(1): 263.
[16]	Shen H, Jiang Y T, Qiu C, et al. Abnormal amyloid precursor protein processing in periodontal tissue in a murine model of periodontitis induced by Porphyromonas gingivalis[J]. J Periodontal Res, 2024, 59(2): 395-407.
[17]	Jiang M Z, Zhang X W, Yan X, et al. GSK3β is involved in promoting Alzheimer′s disease pathologies following chronic systemic exposure to Porphyromonas gingivalis lipopolysaccharide in amyloid precursor protein^NL-F/NL-F knock-in mice[J]. Brain Behav Immun, 2021, 98: 1-12.
[18]	Zhang X, Zhang X, Qiu C, et al. The imbalance of Th17/Treg via STAT3 activation modulates cognitive impairment in P. gingivalis LPS-induced periodontitis mice[J]. J Leukoc Biol, 2021, 110(3): 511-524.
[19]	Qiu C, Yuan Z, He Z Y, et al. Lipopolysaccharide preparation derived from Porphyromonas gingivalis induces a weaker immuno-inflammatory response in BV-2 microglial cells than Escherichia coli by differentially activating TLR2/4-mediated NF-κB/STAT3 signaling pathways[J]. Front Cell Infect Microbiol, 2021, 11: 606986.
[20]	Hajishengallis G, Chavakis T. Local and systemic mechanisms linking periodontal disease and inflammatory comorbidities[J]. Nat Rev Immunol, 2021, 21(7): 426-440.
[21]	Huang X W, Hussain B, Chang J L. Peripheral inflammation and blood-brain barrier disruption: effects and mechanisms[J]. CNS Neurosci Ther, 2021, 27(1): 36-47.
[22]	Sweeney M D, Zhao Z, Montagne A, et al. Blood-brain barrier: from physiology to disease and back[J]. Physiol Rev, 2019, 99(1): 21-78.
[23]	Zlokovic B V. The blood-brain barrier in health and chronic neurodegenerative disorders[J]. Neuron, 2008, 57(2): 178-201.