Expression of sorting nexin 1 in pancreatic ductal adenocarcinoma and its mechanism in promoting PDAC progress

doi:10.3969/j.issn.1674-8115.2023.03.003

Abstract

Abstract:

Objective Methods ·The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) database and the GSE15471 dataset in Gene Expression Omnibus (GEO) database were used to analyze the SNX1 mRNA expression in PDAC and normal pancreas tissues. Immunohistochemistry staining (IHC) was used to detect the SNX1 expression in PDAC and para-carcinoma tissues. The mRNA and protein levels of SNX1 in hTERT-HPNE cells and PDAC cells were detected by quantitative real-time PCR (qPCR) and Western blotting. CCK8 method, plate clonal formation experiment, cell scratch assays and flow cytometry (FCM) were used to detect changes of the proliferation, migration and apoptosis levels in AsPC-1 and Capan-1 cells caused by transfection siRNAs. Capan-1 cell line with stable knockdown of SNX1 was constructed, and the subcutaneous tumorigenesis experiment in nude mice was performed to detect the effect of SNX1 knockdown on the proliferation capacity of cells in nude mice. Immunofluorescence (IF) was used to determine the distribution of SNX1 in PDAC cells, and TMR-dextran was used to detect the changes of macropinocytosis levels of AsPC-1 and Capan-1 cells induced bytransfection siRNAs. Gene Set Enrichment Analysis (GSEA) was performed to predict SNX1 related signaling pathways. The transforming growth factor-β (TGF-β) signaling pathway was selected for subsequent analysis and experimental verification. Capan-1 and AsPC-1 cell lines with stable overexpression of SNX1 were constructed and treated with TGF-β signaling pathway inhibitor Oxymatrine (Oxy). CCK8 method, plate clonal formation experiment, cell scratch assays, FCM and TMR-dextran were used to detect the effects of Oxy treatment on the changes of the proliferation, migration, apoptosis and macropinocytosis levels of the cells caused by SNX1 overexpression. Results ·The results of combined analysis of TCGA and GTEx databases showed that the expression of SNX1 mRNA in PDAC tissues was higher than that in normal pancreas tissues, and the results of GSE15471 dataset analysis showed that the expression of SNX1 mRNA in PDAC tissues was higher than that in para-carcinoma tissues (both P=0.000). IHC results showed that the expression of SNX1 in cancer tissues of PDAC patients was also higher than that in para-carcinoma tissues. qPCR and Western blotting results showed that compared with hTERT-HPNE cells, the mRNA and protein levels of SNX1 in PDAC cells were up-regulated (all P<0.05). SNX1 knockdown could inhibit the proliferation and migration capacity of PDAC cells, down-regulate the macropinocytosis levels of PDAC cells, and promote their apoptosis. On the contrary, SNX1 overexpression led to opposite phenotype. Meanwhile, SNX1 knockdown could inhibit the proliferation capacity of Capan-1 cells in nude mice. IF results showed that SNX1 was colocalized with lysosomes in PDAC cells. GSEA analysis demonstrated that SNX1 expression was correlated with apoptosis, tricarboxylic acid cycle, TGF-β and phosphoinositide 3-kinase-serine/threonine-protein kinase-mammalian target of rapamycin signaling pathway. SNX1 knockdown in PDAC cells could inhibit the activation of TGF-β signaling pathway, SNX1 overexpression could promote this pathway, and TGF-β signaling pathway inhibitor Oxy could inhibit the phenotypic changes caused by SNX1 overexpression. Conclusion SNX1 is highly expressed in PDAC cells and tissues. SNX1 promotes the proliferation, migration capacity and macropinocytosis levels, and inhibits cell apoptosis by activating the TGF-β signaling pathway in PDAC cells. · ·To explore the expression changes of sorting nexin 1 (SNX1) in the occurrence and development of pancreatic ductal adenocarcinoma (PDAC) and its effect on the proliferation, migration, apoptosis and micropinocytosis of PDAC cells, and analyze its molecular mechanism to promote the progression of PDAC.

Key words: pancreatic ductal adenocarcinoma (PDAC), sorting nexin 1 (SNX1), macropinocytosis, transforming growth factor-β signaling pathway

CLC Number:

R735.9

PAN Hong, LIAO Yingna, GAI Yanzhi, QIAN Liheng, NIE Huizhen. Expression of sorting nexin 1 in pancreatic ductal adenocarcinoma and its mechanism in promoting PDAC progress[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 278-292.

Figures/Tables 10

Tab 1 Sequences of siRNA

siRNA	Forward (5′→3′)	Reverse (5′→3′)
NC-siRNA	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT
SNX1-siRNA1	GAGGAUCAAUUUGAUUUGATT	TTCUCCUAGUUAAACUAAACU
SNX1-siRNA2	CAGGCCAACAAUGACUUCUTT	TTGUCCGGUUGUUACUGAAGA

Tab 2 Primer sequences for qPCR

Primer	Forward (5′→3′)	Reverse (5′→3′)
18s	TGCGAGTACTCAACACCAACA	GCATATCTTCGGCCCACA
SNX1	AAGCACTCTCAGAATGGCTTC	CGGCCCTCCGTTTTTCAAG

Tab 3 Sequences of shRNA

shRNA	Sequence (5′→3′)
NC-shRNA	CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG
SNX1-shRNA	CCGGTAGGTGGTGGAATTATGGGATCTCGAGATCCCATAATTCCACCACCTATTTTT

Fig 1 Expression of SNX1 in PDAC cells and tissues and its correlation with clinical characteristics of patients

Fig 2 Effect of SNX1 knockdown on the proliferation capacity of PDAC cells in vivo and in vitro

Fig 3 Effect of SNX1 knockdown on the apoptosis levels and migration capacity of PDAC cells

Fig 4 Distribution of SNX1 in PDAC cells and the effect of SNX1 knockdown on the macropinocytosis levels in PDAC cells

Fig 5 Screening of SNX1-related signaling pathway and the effect of SNX1 knockdown on pathway activation

Fig 6 Effects of Oxy treatment on PDAC cells and key proteins expression in TGF-β signaling pathway induced by SNX1 overexpression (Ⅰ)

Fig 7 Effects of Oxy treatment on PDAC cells and key proteins expression in TGF-β signaling pathway induced by SNX1 overexpression (Ⅱ)

TrendMD

References 20

1	ENCARNACIÓN-ROSADO J, KIMMELMAN A C. Harnessing metabolic dependencies in pancreatic cancers[J]. Nat Rev Gastroenterol Hepatol, 2021, 18(7): 482-492.
2	AMRUTKAR M, GLADHAUG I P. Pancreatic cancer chemoresistance to gemcitabine[J]. Cancers (Basel), 2017, 9(11): 157.
3	SALLY Á, MCGOWAN R, FINN K, et al. Current and future therapies for pancreatic ductal adenocarcinoma[J]. Cancers (Basel), 2022, 14(10): 2417.
4	CHEN Y H, MA X E, CUI Y Y. The research status of the Sorting Nexins Family[J]. Chin Sci Bull, 2014, 59(35): 3442-3449.
5	ZHAN X Y, ZHANG Y Q, ZHAI E T, et al. Sorting nexin-1 is a candidate tumor suppressor and potential prognostic marker in gastric cancer[J]. PeerJ, 2018, 6: e4829.
6	PUCCINI J, BADGLEY M A, BAR-SAGI D. Exploiting cancer's drinking problem: regulation and therapeutic potential of micropinocytosis[J]. Trends Cancer, 2022, 8(1): 54-64.
7	KAY R R. Macropinocytosis: biology and mechanisms[J]. Cells Dev, 2021, 168: 203713.
8	COMMISSO C, DAVIDSON S M, SOYDANER-AZELOGLU R G, et al. Macropinocytosis of protein is an amino acid supply route in Ras-transformed cells[J]. Nature, 2013, 497(7451): 633-637.
9	MURANEN T, IWANICKI M P, CURRY N L, et al. Starved epithelial cells uptake extracellular matrix for survival[J]. Nat Commun, 2017, 8: 13989.
10	DAVIDSON S M, JONAS O, KEIBLER M A, et al. Direct evidence for cancer-cell-autonomous extracellular protein catabolism in pancreatic tumors[J]. Nat Med, 2017, 23(2): 235-241.
11	LIU H Q, QIAN F. Exploiting macropinocytosis for drug delivery into KRAS mutant cancer[J]. Theranostics, 2022, 12(3): 1321-1332.
12	PRINCIPE D R, TIMBERS K E, ATIA L G, et al. TGF-β signaling in the pancreatic tumor microenvironment[J]. Cancers (Basel), 2021, 13(20): 5086.
13	RAMIREZ C, HAUSER A D, VUCIC E A, et al. Plasma membrane V-ATPase controls oncogenic RAS-induced macropinocytosis[J]. Nature, 2019, 576(7787): 477-481.
14	SWANSON J A. Shaping cups into phagosomes and macropinosomes[J]. Nat Rev Mol Cell Biol, 2008, 9(8): 639-649.
15	ZHANG Y F, LI Q, HUANG P Q, et al. A low amino acid environment promotes cell macropinocytosis through the YY1-FGD6 axis in Ras-mutant pancreatic ductal adenocarcinoma[J]. Oncogene, 2022, 41(8): 1203-1215.
16	KERR M C, LINDSAY M R, LUETTERFORST R, et al. Visualisation of macropinosome maturation by the recruitment of sorting nexins[J]. J Cell Sci, 2006, 119(Pt 19): 3967-3980.
17	ZDŻALIK-BIELECKA D, POŚWIATA A, KOZIK K, et al. The GAS6-AXL signaling pathway triggers actin remodeling that drives membrane ruffling, macropinocytosis, and cancer-cell invasion[J]. Proc Natl Acad Sci U S A, 2021, 118(28): e2024596118.
18	KIM S M, NGUYEN T T, RAVI A, et al. PTEN deficiency and AMPK activation promote nutrient scavenging and anabolism in prostate cancer cells[J]. Cancer Discov, 2018, 8(7): 866-883.
19	ZHANG M S, CUI J D, LEE D, et al. Hypoxia-induced macropinocytosis represents a metabolic route for liver cancer[J]. Nat Commun, 2022, 13(1): 954.
20	LEE S W, ZHANG Y J, JUNG M, et al. EGFR-Pak signaling selectively regulates glutamine deprivation-induced macropinocytosis[J]. Dev Cell, 2019, 50(3): 381-392.e5.

[1]	YANG Yanzhao, CHANG Rui, WANG Qingrou, ZHU Naiyi, LI Ruokun, CHAI Weimin, YAN Fuhua. Optimized study of virtual monoenergetic images derived from a dual-layer spectral detector CT in the preoperative evaluation of pancreatic ductal adenocarcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1323-1328.
[2]	JIANG Gan, YANG Yuquan, CHEN Yaoxing, HOU Zhaoyuan, GAO Xiaoling, CHEN Hongzhuan, JIA Hao. Preliminary study on the cellular level of SARS-CoV-2 proteins mediated by macropinocytosis pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 987-996.
[3]	ZHANG Xiuqi, SHEN Baiyong. Advances in cytological mechanism of neural invasion in pancreatic ductal adenocarcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 833-838.