Expression of adhesion G protein-coupled receptor F1 in pancreatic ductal adenocarcinoma and its mechanism of promoting cancer progression

doi:10.3969/j.issn.1674-8115.2024.01.003

Abstract

Abstract:

Objective ·To analyze the expression changes of adhesion G protein-coupled receptor F1 (ADGRF1) in the occurrence and development of pancreatic ductal adenocarcinoma (PDAC), and explore the impact of ADGRF1 on the proliferation of PDAC cells and the potential molecular mechanisms that promote PDAC progression. Methods ·The expression of ADGRF1 at mRNA level was analyzed based on the Gene Expression Omnibus (GEO) database and The Cancer Genome Atlas (TCGA) database, respectively. The expression of ADGRF1 in normal pancreatic ductal epithelial cells (hTERT-HPNE) and various PDAC tumor cells was detected by using real-time fluorescence quantitative PCR (qPCR) and Western blotting. Immunohistochemical staining (IHC) was used to detect the differential expression of ADGRF1 in cancer tissues and adjacent tissues of PDAC patients. After knocking down ADGRF1 with small interfering RNA (siRNA) transfection, the changes in the proliferation ability of PDAC AsPC-1 and SW1990 cells were detected through CCK8 assay and plate cloning experiment. Stable overexpression of ADGRF1 was constructed in PDAC Patu8988 cell line, and the proliferation changes induced by overexpression of ADGRF1 were evaluated through CCK8 assay. RNA sequencing (RNA-seq), gene set enrichment analysis (GSEA), and immune infiltration analysis were utilized to predict signaling pathways associated with ADGRF1-mediated promotion of PDAC cancer progression. Results ·Analysis of the TCGA database and GEO database revealed higher expression of ADGRF1 mRNA in PDAC tissues compared to normal pancreatic tissues (all P=0.000). qPCR and Western blotting results demonstrated up-regulation of ADGRF1 mRNA and protein levels in various PDAC cells compared to hTERT-HPNE cells (all P<0.05). IHC results confirmed higher ADGRF1 expression in PDAC cancer tissues compared to adjacent tissues. Furthermore, downregulation of ADGRF1 inhibited the proliferation of PDAC AsPC-1 and SW1990 cell lines, while overexpression of ADGRF1 promoted the proliferation of Patu8988 cells (all P<0.05). RNA-seq, GSEA enrichment analysis, and immune infiltration analysis revealed that ADGRF1 expression was related to signaling pathways such as interferon-α (IFN-α), tumor necrosis factor-α (TNF-α), and nuclear factor κB (NF-κB). Conclusion ·ADGRF1 is highly expressed in PDAC cells and tissues, and promotes the proliferation of PDAC cells via immune-related signaling pathways.

Key words: pancreatic ductal adenocarcinoma (PDAC), adhesion G protein-coupled receptor F1 (ADGRF1), immunity, tumor-promoting effect

CLC Number:

R735.9

CHEN Suyuan, Mutailifu Musitaba, LI Dongxue, ZHANG Zhigang. Expression of adhesion G protein-coupled receptor F1 in pancreatic ductal adenocarcinoma and its mechanism of promoting cancer progression[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(1): 23-34.

Figures/Tables 8

Tab 1 Primer sequences for qPCR

Primer	Forward (5′→3′)	Reverse (5′→3′)
18s	TGCGAGTACTCAACACCAACA	GCATATCTTCGGCCCACA
ADGRF1	TTCGGCAAGTTCGATGAATTAGC	CACGCATGTTCAGATCCACCT

Tab 2 Sequence of siRNA and overexpression primer sequence

siRNA or gene	Forward (5′→3′)	Reverse (5′→3′)
NC-siRNA	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT
ADGRF1-siRNA1	UGGUCACAUGGGCUAAUUATT	UAAUUAGCCCAUGUGACCAUA
ADGRF1-siRNA2	UCUCAUUAUAUCUGUCAUUTT	AAUGACAGAUAUAAUGAGAGG
ADGRF1	CGCAAATGGGCGGTAGGCGTG	AGAGACAGCAACCAGGAT

Fig 1 Expression of aGPCR in PDAC and normal pancreatic tissues

Fig 2 Impact of increased expression of ADGRC3, ADGRF1 and ADGRG6 on patient prognosis, tumor staging, and grading in PDAC patients

Fig 3 Analysis of the expression a of ADGRF1 in PDAC tissues and cells

Fig 4 Promoting effect of ADGRF1 on the proliferation of PDAC cells

Fig 5 GO and KEGG analysis of RNA-seq results

Fig 6 Results of ADGRF1 in GSEA enrichment analysis and immune infiltration analysis

TrendMD

References 20

1	BENGTSSON A, ANDERSSON R, ANSARI D. The actual 5-year survivors of pancreatic ductal adenocarcinoma based on real-world data[J]. Sci Rep, 2020, 10(1): 16425.
2	GUO X F, SONG Y N, XU P J, et al. Selective extended dissection for pancreaticoduodenectomy is associated with better survival in pancreatic cancer patients: retrospective cohort study[J]. Int J Surg, 2023, 109(7): 1852-1862.
3	GOTTUMUKKALA S, SALAMEKH S, SANFORD N N. Current state and future directions of radiation therapy for pancreas adenocarcinoma[J]. Surg Oncol Clin N Am, 2023, 32(3): 399-414.
4	SMAGLO B G. Role for neoadjuvant systemic therapy for potentially resectable pancreatic cancer[J]. Cancers, 2023, 15(8): 2377.
5	REGAN S L, WILLIAMS M T, VORHEES C V. Latrophilin-3 disruption: effects on brain and behavior[J]. Neurosci Biobehav Rev, 2021, 127: 619-629.
6	HAMANN J, AUST G, ARAÇ D, et al. International Union of Basic and Clinical Pharmacology. ⅩCⅣ. Adhesion G protein-coupled receptors[J]. Pharmacol Rev, 2015, 67(2): 338-367.
7	LIEBSCHER I, CEVHEROĞLU O, HSIAO C C, et al. A guide to adhesion GPCR research[J]. FEBS J, 2022, 289(24): 7610-7630.
8	SASAKI S I, ZHANG D, IWABUCHI S, et al. Crucial contribution of GPR56/ADGRG1, expressed by breast cancer cells, to bone metastasis formation[J]. Cancer Sci, 2021, 112(12): 4883-4893.
9	WU G X, ZHAI D F, XIE J M, et al. N⁶-methyladenosine (m⁶ A) RNA modification of G protein-coupled receptor 133 increases proliferation of lung adenocarcinoma[J]. FEBS Open Bio, 2022, 12(3): 571-581.
10	MOSCA S, CARDINALI G, FLORI E, et al. The PI3K pathway induced by αMSH exerts a negative feedback on melanogenesis and contributes to the release of pigment[J]. Pigment Cell Melanoma Res, 2021, 34(1): 72-88.
11	ABBAS A, JUN P, YUAN J Y, et al. Downregulation of GPR160 inhibits the progression of glioma through suppressing epithelial to mesenchymal transition (EMT) biomarkers[J]. Basic Clin Pharmacol Toxicol, 2022, 131(4): 241-250.
12	LUM A M, WANG B B, BECK-ENGESER G B, et al. Orphan receptor GPR110, an oncogene overexpressed in lung and prostate cancer[J]. BMC Cancer, 2010, 10: 40.
13	MA B T, ZHU J J, TAN J, et al. Gpr110 deficiency decelerates carcinogen-induced hepatocarcinogenesis via activation of the IL-6/STAT3 pathway[J]. Am J Cancer Res, 2017, 7(3): 433-447.
14	BHAT R R, YADAV P, SAHAY D, et al. GPCRs profiling and identification of GPR110 as a potential new target in HER2⁺ breast cancer[J]. Breast Cancer Res Treat, 2018, 170(2): 279-292.
15	ZHU X L, HUANG G Q, JIN P F. Clinicopathological and prognostic significance of aberrant G protein-couple receptor 110 (GPR110) expression in gastric cancer[J]. Pathol Res Pract, 2019, 215(3): 539-545.
16	DE GROOT D M, VOGEL G, DULOS J, et al. Therapeutic antibody targeting of CD97 in experimental arthritis: the role of antigen expression, shedding, and internalization on the pharmacokinetics of anti-CD97 monoclonal antibody 1B2[J]. J Immunol, 2009, 183(6): 4127-4134.
17	GIERA S, LUO R, YING Y Q, et al. Microglial transglutaminase-2 drives myelination and myelin repair via GPR56/ADGRG1 in oligodendrocyte precursor cells[J]. eLife, 2018, 7: e33385.
18	NILE A H, HANNOUSH R N. Fatty acid recognition in the Frizzled receptor family[J]. J Biol Chem, 2019, 294(2): 726-736.
19	LIU Z Q, ZHANG G R, ZHAO C L, et al. Clinical significance of G protein-coupled receptor 110 (GPR110) as a novel prognostic biomarker in osteosarcoma[J]. Med Sci Monit, 2018, 24: 5216-5224.
20	ABDULKAREEM N M, BHAT R, QIN L F, et al. A novel role of ADGRF1 (GPR110) in promoting cellular quiescence and chemoresistance in human epidermal growth factor receptor 2-positive breast cancer[J]. FASEB J, 2021, 35(7): e21719.

[1]	ZHOU Haixia, ZHANG Jing. Research progress of m⁶A methylation modification in regulating tumor immunity [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(1): 137-144.
[2]	LI Junru, OUYANG Yan, XIE Jingyuan. Research progress in the role of gut microbiota in the pathogenesis and treatment of IgA nephropathy [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(8): 1044-1048.
[3]	ZHOU Xiaowen, LI Qian, ZHANG Zhe, SHEN Jianfeng, FAN Xianqun. RBX1 regulates uveal melanoma immune-related genes via STAT1 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 709-717.
[4]	PAN Hong, LIAO Yingna, GAI Yanzhi, QIAN Liheng, NIE Huizhen. Expression of sorting nexin 1 in pancreatic ductal adenocarcinoma and its mechanism in promoting PDAC progress [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 278-292.
[5]	ZHAO Zhuoming, LIU Zhenhao, LU Manman, ZHANG Yu, XU Linfeng, XIE Lu. Analysis of tumor-related features of non-small cell lung cancer based on TCR repertoire workflow [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1520-1528.
[6]	YANG Yanzhao, CHANG Rui, WANG Qingrou, ZHU Naiyi, LI Ruokun, CHAI Weimin, YAN Fuhua. Optimized study of virtual monoenergetic images derived from a dual-layer spectral detector CT in the preoperative evaluation of pancreatic ductal adenocarcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1323-1328.
[7]	LIN Jiayu, QIN Jiejie, JIANG Lingxi. Progress in metabolism of the immune cells in tumor microenvironment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 1122-1130.
[8]	ZHANG Xiuqi, SHEN Baiyong. Advances in cytological mechanism of neural invasion in pancreatic ductal adenocarcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 833-838.
[9]	Ling-ling LI, Qian LI, Ming-yu LI, Zheng LIU, Qian-cheng SHEN. Analysis of tumor immune-related differentially expressed genes in adults and children with acute myeloid leukemia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(5): 579-587.
[10]	ZHAO Wei-guang, LIU Zhi-hong. Advances in study of regulation of tumor immune inflammatory microenvironment by cancer-associated fibroblasts [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1288-1293.
[11]	HE Chun-ming, YIN Hang, ZHENG Jia-jie, TANG Jian, FU Yu-jie, ZHAO Xiao-jing. Immunotherapy for lung cancer: immunosuppressive cells and intrapulmonary immunity [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(8): 1137-1142.
[12]	ZHOU Zhen, XU Yun-hua, ZHANG Fei-fei, ZHAO Yi, GUO Lin, FU Guo-long, SHEN Sheng-ping, LENG Xue-jiao. Establishment of a lung cancer momodel with humanized immunity and its role in efficacy evaluation of programmed death-1 inhibitors [J]. , 2020, 40(1): 37-.
[13]	HONG Zu-bei, JI Wen-ting, QIU Li-hua, DI Wen, LOU Wei-hua. Expression of T helper cell 17-related immune factors in women of child bearing age with human papillomavirus subclinical cervical infection [J]. , 2018, 38(7): 759-.
[14]	FU Yu-jie, GAO Jian-xin, LI Lin-feng, ZHAO Xiao-jing. Correlation and function of NK cells and NKDCs [J]. , 2016, 36(6): 814-.
[15]	YE Juan, GAO Meng-zhe, ZHANG Shu-lin, et al. Immunological evaluation of subunit vaccine prepared by combining specific antigen Rv3117 of Mycobacterium tuberculosis with DDA/MPL adjuvant [J]. , 2015, 35(1): 6-.