Journal of Shanghai Jiao Tong University (Medical Science) ›› 2023, Vol. 43 ›› Issue (7): 804-813.doi: 10.3969/j.issn.1674-8115.2023.07.002
• Biomaterials and regenerative medicine column • Previous Articles
CHEN Zehao1,2(), LÜ Zhendong3(
), ZHANG Zhen1, CUI Wenguo2(
), ZHANG Yuhui1,3(
)
Received:
2023-03-05
Accepted:
2023-05-18
Online:
2023-07-28
Published:
2023-07-28
Contact:
CUI Wenguo,ZHANG Yuhui
E-mail:844186744@qq.com;lvzhendongyyy@126.com;wgcui80@hotmail.com;zhangyuhui@renji.com
Supported by:
CLC Number:
CHEN Zehao, LÜ Zhendong, ZHANG Zhen, CUI Wenguo, ZHANG Yuhui. Effect of hydrogel stiffness on nucleus pulposus cell phenotypes in vitro and its repairment of intervertebral disc in vivo[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(7): 804-813.
Gene | Primer sequence (5′→3′) |
---|---|
Sox9 | |
Forward | AGCACAAGAAAGACCACCCC |
Reverse | GACCCTGAGATTGCCCGGAG |
Acan | |
Forward | GACCTGTGTGAGATCGACCA |
Reverse | GTTGGTTTGGACGCCACTTC |
Ncam-1 | |
Forward | TGGTCAAGTACAGAGCGAAGC |
Reverse | AGGGACTTGAGCATGACGTG |
Gapdh | |
Forward | GACAGCCGCATCTTCTTGTG |
Reverse | ATCCGTTCACACCGACCTTC |
Tab 1 Primer sequences for qPCR
Gene | Primer sequence (5′→3′) |
---|---|
Sox9 | |
Forward | AGCACAAGAAAGACCACCCC |
Reverse | GACCCTGAGATTGCCCGGAG |
Acan | |
Forward | GACCTGTGTGAGATCGACCA |
Reverse | GTTGGTTTGGACGCCACTTC |
Ncam-1 | |
Forward | TGGTCAAGTACAGAGCGAAGC |
Reverse | AGGGACTTGAGCATGACGTG |
Gapdh | |
Forward | GACAGCCGCATCTTCTTGTG |
Reverse | ATCCGTTCACACCGACCTTC |
1 | SCHUBERT A K, SMINK J J, PUMBERGER M, et al. Standardisation of basal medium for reproducible culture of human annulus fibrosus and nucleus pulposus cells[J]. J Orthop Surg Res, 2018, 13(1): 209. |
2 | GUIMARAES C F, GASPERINI L, MARQUES A P, et al. The stiffness of living tissues and its implications for tissue engineering[J]. Nat Rev Mater, 2020, 5(5): 351-370. |
3 | HE J, CHEN C, CHEN L, et al. Honeycomb-like hydrogel microspheres for 3D bulk construction of tumor models[J]. Research (Wash D C), 2022, 2022: 9809763. |
4 | YIP C H, CHEN A D, WONG Y H, et al. Multiphoton microfabrication and micropatternining (MMM)-based screening of multiplex cell niche factors for phenotype maintenance-Bovine nucleus pulposus cell as an example[J]. Biomaterials, 2022, 281: 121367. |
5 | WANG B, KE W, WANG K, et al. Mechanosensitive ion channel Piezo1 activated by matrix stiffness regulates oxidative stress-induced senescence and apoptosis in human intervertebral disc degeneration[J]. Oxid Med Cell Longev, 2021, 2021: 8884922. |
6 | LIANG T, ZHANG L L, XIA W, et al. Individual collagen fibril thickening and stiffening of annulus fibrosus in degenerative intervertebral disc[J]. Spine, 2017, 42(19): E1104-E1111. |
7 | CHON B H, LEE E J, JING L, et al. Human umbilical cord mesenchymal stromal cells exhibit immature nucleus pulposus cell phenotype in a laminin-rich pseudo-three-dimensional culture system[J]. Stem Cell Res Ther, 2013, 4(5): 120. |
8 | ZHANG C, WANG F, XIE Z, et al. The hippo pathway orchestrates cytoskeletal organisation during intervertebral disc degeneration[J]. Acta Histochem, 2021, 123(6): 151770. |
9 | FEARING B V, JING L F, BARCELLONA M N, et al. Mechanosensitive transcriptional coactivators MRTF-A and YAP/TAZ regulate nucleus pulposus cell phenotype through cell shape[J]. FASEB J, 2019, 33(12): 14022-14035. |
10 | KLOTZ B J, GAWLITTA D, ROSENBERG A J W P, et al. Gelatin-methacryloyl hydrogels: towards biofabrication-based tissue repair[J]. Trends Biotechnol, 2016, 34(5): 394-407. |
11 | CAI C D, ZHANG X S, LI Y G, et al. Self-healing hydrogel embodied with macrophage-regulation and responsive-gene-silencing properties for synergistic prevention of peritendinous adhesion[J]. Adv Mater, 2022, 34(5): e2106564. |
12 | SCHUURMAN W, LEVETT P A, POT M W, et al. Gelatin-methacrylamide hydrogels as potential biomaterials for fabrication of tissue-engineered cartilage constructs[J]. Macromol Biosci, 2013, 13(5): 551-561. |
13 | LIU Z, ZHAO B, ZHANG L, et al. Modulated integrin signaling receptors of stem cells via ultra-soft hydrogel for promoting angiogenesis[J]. Compos B Eng, 2022, 234: 109747. |
14 | ZHANG T, LIN S Y, SHAO X R, et al. Regulating osteogenesis and adipogenesis in adipose-derived stem cells by controlling underlying substrate stiffness[J]. J Cell Physiol, 2018, 233(4): 3418-3428. |
15 | MASUDA K, AOTA Y, MUEHLEMAN C, et al. A novel rabbit model of mild, reproducible disc degeneration by an anulus needle puncture: correlation between the degree of disc injury and radiological and histological appearances of disc degeneration[J]. Spine, 2005, 30(1): 5-14. |
16 | YU Z H, JI Y C, LI K, et al. Stiffness of the extracellular matrix affects apoptosis of nucleus pulposus cells by regulating the cytoskeleton and activating the TRPV2 channel protein[J]. Cell Signal, 2021, 84: 110005. |
17 | VINING K H, MOONEY D J. Mechanical forces direct stem cell behaviour in development and regeneration[J]. Nat Rev Mol Cell Biol, 2017, 18(12): 728-742. |
18 | DALY A C, RILEY L, SEGURA T, et al. Hydrogel microparticles for biomedical applications[J]. Nat Rev Mater, 2020, 5(1): 20-43. |
19 | SHIRAHAMA H, LEE B H, TAN L P, et al. Precise tuning of facile one-pot gelatin methacryloyl (GelMA) synthesis[J]. Sci Rep, 2016, 6: 31036. |
20 | BELL S, REDMANN A L, TERENTJEV E M. Universal kinetics of the onset of cell spreading on substrates of different stiffness[J]. Biophys J, 2019, 116(3): 551-559. |
21 | BARCELLONA M N, SPEER J E, FEARING B V, et al. Control of adhesive ligand density for modulation of nucleus pulposus cell phenotype[J]. Biomaterials, 2020, 250: 120057. |
22 | SCOTT K E, FRALEY S I, RANGAMANI P. A spatial model of YAP/TAZ signaling reveals how stiffness, dimensionality, and shape contribute to emergent outcomes[J]. Proc Natl Acad Sci USA, 2021, 118(20): e2021571118. |
23 | SEDOV E, KOREN E, CHOPRA S, et al. THY1-mediated mechanisms converge to drive YAP activation in skin homeostasis and repair[J]. Nat Cell Biol, 2022, 24(7): 1049-1063. |
24 | JANG M, AN J, OH S W, et al. Matrix stiffness epigenetically regulates the oncogenic activation of the Yes-associated protein in gastric cancer[J]. Nat Biomed Eng, 2021, 5(1): 114-123. |
25 | ZHANG X, CAI D, ZHOU F, et al. Targeting downstream subcellular YAP activity as a function of matrix stiffness with Verteporfin-encapsulated chitosan microsphere attenuates osteoarthritis[J]. Biomaterials, 2020, 232: 119724. |
26 | WANG Y, BAI B, HU Y, et al. Hydrostatic pressure modulates intervertebral disc cell survival and extracellular matrix homeostasis via regulating hippo-YAP/TAZ PATHWAY[J]. Stem Cells Int, 2021, 2021: 5626487. |
27 | XU P P, GUAN J J, CHEN Y, et al. Stiffness of photocrosslinkable gelatin hydrogel influences nucleus pulposus cell properties in vitro[J]. J Cell Mol Med, 2021, 25(2): 880-891. |
28 | BINCH A L A, FITZGERALD J C, GROWNEY E A, et al. Cell-based strategies for IVD repair: clinical progress and translational obstacles[J]. Nat Rev Rheumatol, 2021, 17(3): 158-175. |
[1] | MA Fangfang, QIN Jiejie, REN Lingjie, TANG Xiaomei, LIU Jia, SHI Minmin, JIANG Lingxi. Establishment of a 3D culture model in vitro of pancreatic cancer primary cells using hydrogel microspheres [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 79-87. |
[2] | DONG Jiaoyun, SONG Fei, LU Shuliang, LIU Yan, TIAN Ming. Effects of cryogen spray combined with polymeric hydrogel on acute burn wounds [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 562-569. |
[3] | TANG Biwen, BAI Yaya, HU Yueliang, CHAO Huijuan, WANG Qian, ZUO Junli. Correlation between apnea hypopnea index and arteriosclerosis in patients with obstructive sleep apnea hypopnea syndrome complicated with hypertension [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(4): 490-495. |
[4] | Tung-liang HSIA, Jia-chen DONG, Rong SHU. Application of hydrogel sustained-release system to periodontal tissue regeneration [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 959-962. |
[5] | Chuan-dong CAI, Fei WANG, Wen-guo CUI, Cun-yi FAN, Shen LIU. Fabrication and characterization of matrix metalloproteinase-responsive G4 PAMAM-IBU/GelMA hydrogel [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(2): 140-146. |
[6] | LIU Li-li1, CUI Wen-guo1, 2. Injectable hydrogel loaded with bone morphogenetic protein-2 microspheres for bacteriostasis and osteogenesis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1184-1192. |
[7] | LIANG Zhi-hao, CHEN Zhi-qian, CHEN Chen, ZHOU Yi-fan, YANG Xiao, ZHAO Jie. Effect and mechanism of ginsenoside Re on intervertebral disc degeneration [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(10): 1347-1353. |
[8] | XIANG Yi1, 2, LIU Li-li1, 2, CUI Wen-guo1, 2. Fabrication of an antibacterial hydrogel laden with adhesive liposomes for bone repairment [J]. , 2019, 39(9): 947-. |
[9] | NING Hang, XIA Yi-ru, DONG Jia-chen, SHU Rong. Effect of recombinant human amelogenin-loaded PCLA-PEG-PCLA hydrogels on biological properties of human periodontal ligament fibroblasts [J]. , 2019, 39(3): 244-. |
[10] | WU Ruo-yu, CAO Yi-meng, WU Qing-kai, QIU Yu, HUANG Cheng-sheng, XUE Zhuo-wei. Preventive effect of thermosensitive hydroxybutyl chitosan hydrogel in intrauterine adhesion in New Zealand white rabbits [J]. , 2019, 39(2): 131-. |
[11] | CHENG Ruo-yu, YAN Yu-fei, CHEN Hao, QI Jin, DENG Lian-fu, CUI Wen-guo. Fabrication of dual-functional organic/inorganic osteogenetic hydrogel for bone regeneration [J]. , 2018, 38(8): 900-. |
[12] | CHEN Ming-jiao, FAN Xian-qun. Effect of hyaluronic acid-gelatin double-network hydrogel on osteogenic differentiation of rat bone marrow mesenchymal stem cells [J]. , 2018, 38(7): 722-. |
[13] | CAI Ye-hua, WANG Yong, WANG Yi, CHEN Li . Effect of stiffness parameter β combined with carotid intima-media thickness on predicting ischemic stroke [J]. , 2017, 37(5): 666-. |
[14] | ZUO Jun-li, CHANG Gui-li, GE Qian, et al. Correlation between chronic kidney disease and arterial stiffness of primary hypertensive patients [J]. , 2015, 35(11): 1619-. |
Viewed | ||||||||||||||||||||||||||||||||||||||||||||||||||
Full text 2023
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||
Abstract 764
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||