Effect of hydrogel stiffness on nucleus pulposus cell phenotypes in vitro and its repairment of intervertebral disc in vivo

doi:10.3969/j.issn.1674-8115.2023.07.002

Abstract

Abstract:

Objective ·To investigate the effect of hydrogel stiffness on nucleus pulposus cell phenotype and its function in repairing intervertebral disc degeneration in rats. Methods ·Methacrylate gelatin (GelMA) hydrogels with different concentrations were constructed. The stiffness of the hydrogels was investigated by using rheological analysis and uniaxial compression test. The microstructure and morphology of the hydrogels were observed by scanning electron microscopy (SEM). Nucleus pulposus cells with normal phenotype were inoculated on the surface of GelMA hydrogels. The biocompatibility of the hydrogel was evaluated by live-dead cell staining and the growth pattern of nucleus pulposus cells on hydrogels with different stiffness was observed with phalloidin staining under microscope. Immunofluorescence staining was performed to examine the nuclear localization of Yes-associated protein (YAP) and real-time quantitative reverse transcription PCR (qRT-PCR) was used to detect the expression levels of nucleus pulposus cell-associated genes [neural cell adhesion molecule 1 (Ncam-1), aggrecan (Acan), sex-determing region of Y chromosome (SRY)-box transcription factor 9 (Sox9)]. A rat caudal acupuncture intervertebral disc degeneration model was established. Nucleus pulposus cells cultured on different hydrogels were harvested and injected into the degenerated discs separately. Four weeks after surgery, magnetic resonance imaging (MRI) was performed to analyze the water content of the intervertebral discs in each group. Histological tests were performed to examine the disc structure and proteoglycan levels. Results ·The elastic modulus of the hydrogels was 1 kPa and 200 kPa when the concentration of GelMA prepolymerisation solution was at 4% and 15% respectively. SEM observation revealed that the hydrogels showed a loose and porous microstructure, and the porosity of hydrogels decreased significantly with the decrease of their stiffness. In vitro experiments demonstrated that both GelMA hydrogel mediums showed good biocompatibility and the ability to support cell proliferation. Nucleus pulposus cells cultured on the soft matrix (4%GelMA) had a lower elongation and spreading area than those cultured on the stiff matrix (15%GelMA), showing a tendency of YAP concentration in the cytoplasm. The gene expression of nucleus pulposus cells was examined and the levels of Sox9, Acan and Ncam-1 in the soft matrix hydrogel group were 23.7, 6.6 and 12.7 times of those in the control group respectively. In vivo experiments on rat disc degeneration showed that the soft hydrogel matrix group had higher disc water content and structural integrity than the stiff hydrogel matrix group. Conclusion ·Compared to stiff GelMA hydrogels, hydrogels with low stiffness better maintain the growth phenotypes in the nucleus pulposus cells and have better therapeutic effect on disc degeneration in vivo.

Key words: hydrogel, stiffness, nucleus pulposus cell, Yes-associated protein (YAP), intervertebral disc degeneration

CLC Number:

R681.5

CHEN Zehao, LÜ Zhendong, ZHANG Zhen, CUI Wenguo, ZHANG Yuhui. Effect of hydrogel stiffness on nucleus pulposus cell phenotypes in vitro and its repairment of intervertebral disc in vivo[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(7): 804-813.

Figures/Tables 8

Tab 1 Primer sequences for qPCR

Gene	Primer sequence (5′→3′)
Sox9
Forward	AGCACAAGAAAGACCACCCC
Reverse	GACCCTGAGATTGCCCGGAG
Acan
Forward	GACCTGTGTGAGATCGACCA
Reverse	GTTGGTTTGGACGCCACTTC
Ncam-1
Forward	TGGTCAAGTACAGAGCGAAGC
Reverse	AGGGACTTGAGCATGACGTG
Gapdh
Forward	GACAGCCGCATCTTCTTGTG
Reverse	ATCCGTTCACACCGACCTTC

Fig 1 Synthesis and characteristics of GelMA

Fig 2 Physical characterization of GelMA hydrogels

Fig 3 Morphologic observation of nucleus pulposus cells cultured on soft and stiff hydrogel mediums

Fig 4 Live-dead staining of nucleus pulposus cells cultured on GelMA hydrogels

Fig 5 Localization of YAP in nucleus pulposus cells

Fig 6 Effect of hydrogel matrices with different stiffness on the phenotypes of nucleus pulposus cells

Fig 7 Repair effect of nucleus pulposus cells cultured in hydrogel matrix with different stiffness on intervertebral disc degeneration

TrendMD

References 28

1	SCHUBERT A K, SMINK J J, PUMBERGER M, et al. Standardisation of basal medium for reproducible culture of human annulus fibrosus and nucleus pulposus cells[J]. J Orthop Surg Res, 2018, 13(1): 209.
2	GUIMARAES C F, GASPERINI L, MARQUES A P, et al. The stiffness of living tissues and its implications for tissue engineering[J]. Nat Rev Mater, 2020, 5(5): 351-370.
3	HE J, CHEN C, CHEN L, et al. Honeycomb-like hydrogel microspheres for 3D bulk construction of tumor models[J]. Research (Wash D C), 2022, 2022: 9809763.
4	YIP C H, CHEN A D, WONG Y H, et al. Multiphoton microfabrication and micropatternining (MMM)-based screening of multiplex cell niche factors for phenotype maintenance-Bovine nucleus pulposus cell as an example[J]. Biomaterials, 2022, 281: 121367.
5	WANG B, KE W, WANG K, et al. Mechanosensitive ion channel Piezo1 activated by matrix stiffness regulates oxidative stress-induced senescence and apoptosis in human intervertebral disc degeneration[J]. Oxid Med Cell Longev, 2021, 2021: 8884922.
6	LIANG T, ZHANG L L, XIA W, et al. Individual collagen fibril thickening and stiffening of annulus fibrosus in degenerative intervertebral disc[J]. Spine, 2017, 42(19): E1104-E1111.
7	CHON B H, LEE E J, JING L, et al. Human umbilical cord mesenchymal stromal cells exhibit immature nucleus pulposus cell phenotype in a laminin-rich pseudo-three-dimensional culture system[J]. Stem Cell Res Ther, 2013, 4(5): 120.
8	ZHANG C, WANG F, XIE Z, et al. The hippo pathway orchestrates cytoskeletal organisation during intervertebral disc degeneration[J]. Acta Histochem, 2021, 123(6): 151770.
9	FEARING B V, JING L F, BARCELLONA M N, et al. Mechanosensitive transcriptional coactivators MRTF-A and YAP/TAZ regulate nucleus pulposus cell phenotype through cell shape[J]. FASEB J, 2019, 33(12): 14022-14035.
10	KLOTZ B J, GAWLITTA D, ROSENBERG A J W P, et al. Gelatin-methacryloyl hydrogels: towards biofabrication-based tissue repair[J]. Trends Biotechnol, 2016, 34(5): 394-407.
11	CAI C D, ZHANG X S, LI Y G, et al. Self-healing hydrogel embodied with macrophage-regulation and responsive-gene-silencing properties for synergistic prevention of peritendinous adhesion[J]. Adv Mater, 2022, 34(5): e2106564.
12	SCHUURMAN W, LEVETT P A, POT M W, et al. Gelatin-methacrylamide hydrogels as potential biomaterials for fabrication of tissue-engineered cartilage constructs[J]. Macromol Biosci, 2013, 13(5): 551-561.
13	LIU Z, ZHAO B, ZHANG L, et al. Modulated integrin signaling receptors of stem cells via ultra-soft hydrogel for promoting angiogenesis[J]. Compos B Eng, 2022, 234: 109747.
14	ZHANG T, LIN S Y, SHAO X R, et al. Regulating osteogenesis and adipogenesis in adipose-derived stem cells by controlling underlying substrate stiffness[J]. J Cell Physiol, 2018, 233(4): 3418-3428.
15	MASUDA K, AOTA Y, MUEHLEMAN C, et al. A novel rabbit model of mild, reproducible disc degeneration by an anulus needle puncture: correlation between the degree of disc injury and radiological and histological appearances of disc degeneration[J]. Spine, 2005, 30(1): 5-14.
16	YU Z H, JI Y C, LI K, et al. Stiffness of the extracellular matrix affects apoptosis of nucleus pulposus cells by regulating the cytoskeleton and activating the TRPV2 channel protein[J]. Cell Signal, 2021, 84: 110005.
17	VINING K H, MOONEY D J. Mechanical forces direct stem cell behaviour in development and regeneration[J]. Nat Rev Mol Cell Biol, 2017, 18(12): 728-742.
18	DALY A C, RILEY L, SEGURA T, et al. Hydrogel microparticles for biomedical applications[J]. Nat Rev Mater, 2020, 5(1): 20-43.
19	SHIRAHAMA H, LEE B H, TAN L P, et al. Precise tuning of facile one-pot gelatin methacryloyl (GelMA) synthesis[J]. Sci Rep, 2016, 6: 31036.
20	BELL S, REDMANN A L, TERENTJEV E M. Universal kinetics of the onset of cell spreading on substrates of different stiffness[J]. Biophys J, 2019, 116(3): 551-559.
21	BARCELLONA M N, SPEER J E, FEARING B V, et al. Control of adhesive ligand density for modulation of nucleus pulposus cell phenotype[J]. Biomaterials, 2020, 250: 120057.
22	SCOTT K E, FRALEY S I, RANGAMANI P. A spatial model of YAP/TAZ signaling reveals how stiffness, dimensionality, and shape contribute to emergent outcomes[J]. Proc Natl Acad Sci USA, 2021, 118(20): e2021571118.
23	SEDOV E, KOREN E, CHOPRA S, et al. THY1-mediated mechanisms converge to drive YAP activation in skin homeostasis and repair[J]. Nat Cell Biol, 2022, 24(7): 1049-1063.
24	JANG M, AN J, OH S W, et al. Matrix stiffness epigenetically regulates the oncogenic activation of the Yes-associated protein in gastric cancer[J]. Nat Biomed Eng, 2021, 5(1): 114-123.
25	ZHANG X, CAI D, ZHOU F, et al. Targeting downstream subcellular YAP activity as a function of matrix stiffness with Verteporfin-encapsulated chitosan microsphere attenuates osteoarthritis[J]. Biomaterials, 2020, 232: 119724.
26	WANG Y, BAI B, HU Y, et al. Hydrostatic pressure modulates intervertebral disc cell survival and extracellular matrix homeostasis via regulating hippo-YAP/TAZ PATHWAY[J]. Stem Cells Int, 2021, 2021: 5626487.
27	XU P P, GUAN J J, CHEN Y, et al. Stiffness of photocrosslinkable gelatin hydrogel influences nucleus pulposus cell properties in vitro[J]. J Cell Mol Med, 2021, 25(2): 880-891.
28	BINCH A L A, FITZGERALD J C, GROWNEY E A, et al. Cell-based strategies for IVD repair: clinical progress and translational obstacles[J]. Nat Rev Rheumatol, 2021, 17(3): 158-175.

[1]	MA Fangfang, QIN Jiejie, REN Lingjie, TANG Xiaomei, LIU Jia, SHI Minmin, JIANG Lingxi. Establishment of a 3D culture model in vitro of pancreatic cancer primary cells using hydrogel microspheres [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 79-87.
[2]	DONG Jiaoyun, SONG Fei, LU Shuliang, LIU Yan, TIAN Ming. Effects of cryogen spray combined with polymeric hydrogel on acute burn wounds [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 562-569.
[3]	TANG Biwen, BAI Yaya, HU Yueliang, CHAO Huijuan, WANG Qian, ZUO Junli. Correlation between apnea hypopnea index and arteriosclerosis in patients with obstructive sleep apnea hypopnea syndrome complicated with hypertension [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(4): 490-495.
[4]	Tung-liang HSIA, Jia-chen DONG, Rong SHU. Application of hydrogel sustained-release system to periodontal tissue regeneration [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 959-962.
[5]	Chuan-dong CAI, Fei WANG, Wen-guo CUI, Cun-yi FAN, Shen LIU. Fabrication and characterization of matrix metalloproteinase-responsive G4 PAMAM-IBU/GelMA hydrogel [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(2): 140-146.
[6]	LIU Li-li1, CUI Wen-guo1, 2. Injectable hydrogel loaded with bone morphogenetic protein-2 microspheres for bacteriostasis and osteogenesis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1184-1192.
[7]	LIANG Zhi-hao, CHEN Zhi-qian, CHEN Chen, ZHOU Yi-fan, YANG Xiao, ZHAO Jie. Effect and mechanism of ginsenoside Re on intervertebral disc degeneration [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(10): 1347-1353.
[8]	XIANG Yi1, 2, LIU Li-li1, 2, CUI Wen-guo1, 2. Fabrication of an antibacterial hydrogel laden with adhesive liposomes for bone repairment [J]. , 2019, 39(9): 947-.
[9]	NING Hang, XIA Yi-ru, DONG Jia-chen, SHU Rong. Effect of recombinant human amelogenin-loaded PCLA-PEG-PCLA hydrogels on biological properties of human periodontal ligament fibroblasts [J]. , 2019, 39(3): 244-.
[10]	WU Ruo-yu, CAO Yi-meng, WU Qing-kai, QIU Yu, HUANG Cheng-sheng, XUE Zhuo-wei. Preventive effect of thermosensitive hydroxybutyl chitosan hydrogel in intrauterine adhesion in New Zealand white rabbits [J]. , 2019, 39(2): 131-.
[11]	CHENG Ruo-yu, YAN Yu-fei, CHEN Hao, QI Jin, DENG Lian-fu, CUI Wen-guo. Fabrication of dual-functional organic/inorganic osteogenetic hydrogel for bone regeneration [J]. , 2018, 38(8): 900-.
[12]	CHEN Ming-jiao, FAN Xian-qun. Effect of hyaluronic acid-gelatin double-network hydrogel on osteogenic differentiation of rat bone marrow mesenchymal stem cells [J]. , 2018, 38(7): 722-.
[13]	CAI Ye-hua, WANG Yong, WANG Yi, CHEN Li . Effect of stiffness parameter β combined with carotid intima-media thickness on predicting ischemic stroke [J]. , 2017, 37(5): 666-.
[14]	ZUO Jun-li, CHANG Gui-li, GE Qian, et al. Correlation between chronic kidney disease and arterial stiffness of primary hypertensive patients [J]. , 2015, 35(11): 1619-.