Spatiotemporal distribution and differentiation potential of Col1+ cells in alveolar socket healing

doi:10.3969/j.issn.1674-8115.2026.02.002

Journal of Shanghai Jiao Tong University (Medical Science) ›› 2026, Vol. 46 ›› Issue (2): 143-150.doi: 10.3969/j.issn.1674-8115.2026.02.002

• Basic research • Previous Articles

Spatiotemporal distribution and differentiation potential of Col1⁺ cells in alveolar socket healing

Zhao Yu¹, Zan Bingxin¹, Sun Siyuan², Huang Xiangru², Gao Jie³, Wu Yiqun³(), Jiang Lingyong²(), Dai Qinggang³()

^1.Binzhou Medical University School of Stomatology, Yantai 264003, China
^2.Department of Oral and Maxillofacial Surgery, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine; College of Stomatology, Shanghai Jiao Tong University; National Center for Stomatology; National Clinical Research Center for Oral Diseases; Shanghai Key Laboratory of Stomatology; Shanghai Research Institute of Stomatology, Shanghai 200011, China
^3.Department of Second Dental Centre, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine; College of Stomatology, Shanghai Jiao Tong University; National Center for Stomatology; National Clinical Research Center for Oral Diseases; Shanghai Key Laboratory of Stomatology; Shanghai Research Institute of Stomatology, Shanghai 200011, China

Received:2025-05-05 Accepted:2025-12-19 Online:2026-02-28 Published:2026-02-28
Contact: Wu Yiqun, Jiang Lingyong, Dai Qinggang E-mail:yiqunwu@hotmail.com;jianglingyong@sjtu.edu.cn;daiqinggang@sjtu.edu.cn
Supported by:
"Two-hundred Talents" Program of Shanghai Jiao Tong University School of Medicine(20221809);National Natural Science Foundation of China(82430032,82071083,82271006,82271004,82471007);National Key Research and Development Program of China(2024YFC2510700);Natural Science Foundation of Shanghai(22ZR1436700,21ZR1436900,21ZR1437700,24ZR1491900,25ZR1401217);Cross-disciplinary Research Fund of Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine(JYJC202116,JYJC202411);International Science and Technology Cooperation Project of Shanghai Science and Technology Innovation Action Plan/Inter-Governmental International Science and Technology Cooperation Project(23410713600);Natural Science Foundation of Hainan Province(824MS152);Joint Program on Health Science & Technology Innovation of Hainan(WSJK2025MS196)

Abstract

Abstract:

Objective ·To combine the Cre/loxP recombinase system with a tooth extraction model to explore the spatiotemporal distribution of Col1⁺ cells secreting type Ⅰ collagen (collagen type Ⅰ, COL1) during alveolar socket healing and their potential to differentiate into osteoblasts. Methods ·Col1-CreERT2 mice were mated with Rosa26-LoxP-Stop-LoxP-tdTomato mice to obtain Col1-CreERT2;tdTomato double transgenic offspring mice. Fifteen offspring mice were selected and tamoxifen (TA) was intraperitoneally injected to label the Col1⁺ cell lineage. One week later, the right maxillary first molars of the offspring mice were completely extracted under general anesthesia to establish a double transgenic mouse tooth extraction model. The offspring mice were divided into 5 groups, with 3 mice in each group. Maxillary bone samples were collected at 0, 3, 7, 14, and 28 days after tooth extraction, respectively. Paraffin sections were used to observe the dynamic distribution of the Col1⁺ cell lineage during alveolar socket healing. Immunofluorescence techniques were employed to label the osteoblast-specific transcription factor osterix (OSX), vascular marker endomucin (EMCN), and neuronal marker β3-tubulin to investigate the osteogenic potential of Col1⁺ cells and their spatial localization relationship with blood vessels and nerves. Results ·The tooth extraction model of Col1-CreERT2;tdTomato double transgenic mice was successfully established. Paraffin section observations revealed that Col1⁺ cells appeared in the alveolar socket on the third day after the model was established; on the seventh day, the number of Col1⁺ cells increased and alveolar socket osteogenesis gradually occurred; on the 28th day, the proportion of Col1⁺ cells further increased and they were distributed around the bone trabeculae. The results of statistical analysis showed that the number of Col1⁺ cells increased over time during alveolar socket healing (all P<0.001, compared with day 0). The results of Immunofluorescence assay indicated that the number of Col1⁺ OSX⁺ double-positive cells in the alveolar socket gradually increased from the 7th to the 28th day after the model was established, and Col1⁺ cells were spatially adjacent to EMCN and β3-tubulin. Conclusion ·During alveolar socket healing, Col1⁺ cells have the potential to differentiate into osteoblasts, and may also be involved in the formation of blood vessels and nerves.

Key words: lineage tracing technology, collagen type Ⅰ (COL1), Cre/loxP recombinase system, alveolar socket healing

CLC Number:

R782.11

Zhao Yu, Zan Bingxin, Sun Siyuan, Huang Xiangru, Gao Jie, Wu Yiqun, Jiang Lingyong, Dai Qinggang. Spatiotemporal distribution and differentiation potential of Col1⁺ cells in alveolar socket healing[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(2): 143-150.

Figures/Tables 6

Tab 1 Primer sequences for PCR

Gene	Forward sequence (5'→3')	Reverse sequence (5'→3')
Col1-CreERT2	CGATGCAACGAGTGATGAGG	CGCATAACCAGTGAAACAGC
tdTomato	TTCGGCTTCTGGCGTGTGAC	GAAGAGGAGTGCTCCGATCAGG

Fig 1 Flowchart of the construction and sample collection of the tooth extraction model in double transgenic offspring mice

Fig 2 Genotype identification of double transgenic offspring mice and establishment of the tooth extraction model

Fig 3 Spatiotemporal distribution of Col1+ cells during the healing process of the alveolar socket

Fig 4 Spatiotemporal distribution of Col1+ cells and OSX+ cells during the healing process of the alveolar socket

Fig 5 Detection of the distribution and spatial correlation of Col1+ /EMCN+ cells (A) and Col1+ /β3-tubulin+ cells (B) in alveolar sockets by immunofluorescence assay

TrendMD

References 29

[1]	Wang R Y, Wang T X, Chen Z Y, et al. Bioactive materials from berberine-treated human bone marrow mesenchymal stem cells accelerate tooth extraction socket healing through the jaw vascular unit[J]. Sci China Life Sci, 2025, 68(4): 1025-1041.
[2]	Araújo M G, Dias D R, Matarazzo F. Anatomical characteristics of the alveolar process and basal bone that have an effect on socket healing[J]. Periodontol 2000, 2023, 93(1): 277-288.
[3]	Macbeth N D, Donos N, Mardas N. Alveolar ridge preservation with guided bone regeneration or socket seal technique. A randomised, single-blind controlled clinical trial[J]. Clin Oral Implants Res, 2022, 33(7): 681-699.
[4]	Decker A M, Matsumoto M, Decker J T, et al. Inhibition of Mertk signaling enhances bone healing after tooth extraction[J]. J Dent Res, 2023, 102(10): 1131-1140.
[5]	Zhang D, Zhang S, Wang J, et al. LepR-expressing stem cells are essential for alveolar bone regeneration[J]. J Dent Res, 2020, 99(11): 1279-1286.
[6]	Xie Z Y, Yu W H, Ye G W, et al. Single-cell RNA sequencing analysis of human bone-marrow-derived mesenchymal stem cells and functional subpopulation identification[J]. Exp Mol Med, 2022, 54(4): 483-492.
[7]	Morita R, Fujiwara H. Tracing the developmental origin of tissue stem cells[J]. Dev Growth Differ, 2022, 64(9): 566-576.
[8]	Vanhorn S, Morris S A. Next-generation lineage tracing and fate mapping to interrogate development[J]. Dev Cell, 2021, 56(1): 7-21.
[9]	Liu K, Jin H W, Zhou B. Genetic lineage tracing with multiple DNA recombinases: a user's guide for conducting more precise cell fate mapping studies[J]. J Biol Chem, 2020, 295(19): 6413-6424.
[10]	Jin H W, Liu K, Zhou B. Dual recombinases-based genetic lineage tracing for stem cell research with enhanced precision[J]. Sci China Life Sci, 2021, 64(12): 2060-2072.
[11]	Yi Y, Stenberg W, Luo W, et al. Alveolar bone marrow Gli1⁺ stem cells support implant osseointegration[J]. J Dent Res, 2022, 101(1): 73-82.
[12]	Mizoguchi T, Pinho S, Ahmed J, et al. Osterix marks distinct waves of primitive and definitive stromal progenitors during bone marrow development[J]. Dev Cell, 2014, 29(3): 340-349.
[13]	Oosterlaken B M, Vena M P, De With G. In vitro mineralization of collagen[J]. Adv Mater, 2021, 33(16): 2004418.
[14]	Necula L, Matei L, Dragu D, et al. Collagen family as promising biomarkers and therapeutic targets in cancer[J]. Int J Mol Sci, 2022, 23(20): 12415.
[15]	Hernández-Rangel A, Martin-Martinez E S. Collagen based electrospun materials for skin wounds treatment[J]. J Biomed Mater Res A, 2021, 109(9): 1751-1764.
[16]	Kaku M, Yamamoto T, Yashima Y, et al. Acetaminophen reduces apical root resorption during orthodontic tooth movement in rats[J]. Arch Oral Biol, 2019, 102: 83-92.
[17]	Wang X Y, Huang X R, Gao X, et al. Differentiation potential of periodontal Col1⁺ cells under orthodontic force[J]. Mechanobiol Med, 2023, 2(1): 100026.
[18]	张大力, 张艳, 何佳奇, 等. 二型胶原阳性细胞谱系示踪小鼠模型建立及鉴定[J]. 临床军医杂志, 2025, 53(4): 375-378.
	Zhang D L, Zhang Y, He J Q, et al. Establishment and identification of type 2 collagen-positive cell lineage tracer mouse model[J]. Clinical Journal of Medical Officers, 2025, 53(4): 375-378.
[19]	Zhong Z A, Sun W H, Chen H Y, et al. Optimizing tamoxifen-inducible Cre/loxp system to reduce tamoxifen effect on bone turnover in long bones of young mice[J]. Bone, 2015, 81: 614-619.
[20]	Tokavanich N, Chan B, Strauss K, et al. Control of alveolar bone development, homeostasis, and socket healing by salt-inducible kinases[J]. J Bone Miner Res, 2025, 40(5): 656-670.
[21]	Heselich A, Neff P, Śmieszek-Wilczewska J, et al. Introduction of a semi-quantitative image-based analysis tool for CBCT-based evaluation of bone regeneration in tooth extraction sockets[J]. Bioengineering, 2025, 12(3): 301.
[22]	Loder S, Patel N, Morgani S, et al. Genetic models for lineage tracing in musculoskeletal development, injury, and healing[J]. Bone, 2023, 173: 116777.
[23]	Zhu S Y, Chen W, Masson A, et al. Cell signaling and transcriptional regulation of osteoblast lineage commitment, differentiation, bone formation, and homeostasis[J]. Cell Discov, 2024, 10(1): 71.
[24]	Fan J X, Xie Y H, Liu D S, et al. Crosstalk between H-type vascular endothelial cells and macrophages: a potential regulator of bone homeostasis[J]. J Inflamm Res, 2025, 18: 2743-2765.
[25]	Zhao Y, Cai Y F, Wang W K, et al. Periosteum-bone inspired hierarchical scaffold with endogenous piezoelectricity for neuro-vascularized bone regeneration[J]. Bioact Mater, 2024, 44: 339-353.
[26]	Qin Q Z, Lee S, Patel N, et al. Neurovascular coupling in bone regeneration[J]. Exp Mol Med, 2022, 54(11): 1844-1849.
[27]	Peng Y, Wu S, Li Y S, et al. Type H blood vessels in bone modeling and remodeling[J]. Theranostics, 2020, 10(1): 426-436.
[28]	Pei X, Wang L, Chen C, et al. Contribution of the PDL to osteotomy repair and implant osseointegration[J]. J Dent Res, 2017, 96(8): 909-916.
[29]	Isaka J, Ohazama A, Kobayashi M, et al. Participation of periodontal ligament cells with regeneration of alveolar bone[J]. J Periodontol, 2001, 72(3): 314-323.

Spatiotemporal distribution and differentiation potential of Col1⁺ cells in alveolar socket healing

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 6

TrendMD

References 29

Related Articles 1

Recommended Articles

Metrics

Comments