Different roles of SMAD2 and SMAD3 in human embryonic stem cell differentiation

doi:10.3969/j.issn.1674-8115.2022.04.006

Abstract

Abstract: Objective

·To investigate the different roles of SMAD proteins (drosophila mothers against decapentaplegic proteins)—SMAD2 and SMAD3, the major downstream effectors of the transforming growth factor β (TGFβ) family, in the differentiation process of human embryonic stem cells (hESCs) in vitro.

Methods

·The protein levels of SMAD2 and SMAD3 were measured by Western blotting in hESCs. The SMAD2 knockout (SMAD2KO) and SMAD3 knockout (SMAD3KO) cell lines were constructed in hESCs by CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) technology. Immunofluorescence staining was used to detect the effect of SMAD protein loss on the expression of pluripotent factors octamer-binding transcription factor 4 (OCT4) and sex determining region Y-box 2 (SOX2), neuroectoderm (NE) factors paired box 6 (PAX6) and sex determining region Y-box 1 (SOX1), and mesendoderm (ME) factor SOX17. Flow cytometry was used to identify the expression changes of NE factor PAX6 and ME factor SOX17, eomesodermin (EOMES) and C-X-C motif chemokine receptor 4 (CXCR4) upon SMAD2 or SMAD3 loss. SMAD2 and SMAD3 plasmids were overexpressed in SMAD2KO and SMAD3KO cell lines, respectively, which were verified by Western blotting. Real-time quantitative reverse transcription PCR (qRT-PCR) was used to check whether the recoveries of SMAD proteins in SMADKO cell lines could restore the expression of ME key factors, like EOMES, forkhead box A2 (FOXA2) and goosecoid homeobox (GSC) during differentiation.

Results

·Although the protein sequences of SMAD2 and SMAD3 were similar, SMAD2 was the main factor expressed in hESCs. SMAD2 knockout and SMAD3 knockout did not affect the expression of pluripotent factors OCT4 and SOX2 from immunofluorescence staining results, nor the expression of NE factors PAX6 and SOX1 combined with flow cytometry results. SMAD3 knockout had no significant effect on the differentiation of hESCs into ME, while SMAD2 knockout severely hindered the expression of ME specific factors such as SOX17, EOMES and CXCR4. By qRT-PCR analysis, overexpression of exogenous SMAD2 in SMAD2KO cells can effectively restore the expression of ME genes including EOMES, FOXA2 and GSC, while replenishment of SMAD3 in SMAD3KO cells almost had no effect.

Conclusion

·SMAD2 and SMAD3 play different roles in the ME differentiation of hESCs. SMAD2, but not SMAD3, is critical for the expression of ME genes in hESCs.

Key words: human embryonic stem cell (hESC), mesendoderm differentiation, SMAD2, SMAD3

CLC Number:

R329.2

ZHAO Bingnan, MA Shuangyu, XU Chunlong, WANG Qiong. Different roles of SMAD2 and SMAD3 in human embryonic stem cell differentiation[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(4): 443-454.

Figures/Tables 6

Tab 1 Primer sequences for qRT-PCR

Gene	Forward primer （5'→3'）	Reverse primer （5'→3'）
GAPDH	GGAGCCAAACGGGTCATCATCTC	GAGGGGCCATCCACAGTCTTCT
EOMES	CGGCCTCTGTGGCTCAAA	AAGGAAACATGCGCCTGC
FOXA2	GGGAGCGGTGAAGATGGA	TCATGTTGCTCACGGAGGAGTA
GSC	AACGCGGAGAAGTGGAACAAG	CTGTCCGAGTCCAAATCGC

Fig 1 Expression pattern of SMAD2 and SMAD3

Fig 2 Influence of SMAD2 knockout or SMAD3 knockout on the expression of pluripotent factors in hESCs

Fig 3 Effect of SMAD2 knockout or SMAD3 knockout on the NE differentiation of hESC

Fig 4 Effect of SMAD2 knockout or SMAD3 knockout on the DE differentiation of hESC

Fig 5 Effect of overexpressing exogenous SMAD2 in SMAD2KO cells on the ME differentiation

TrendMD

References 26

1	DAVID C J, MASSAGUÉ J. Contextual determinants of TGFβ action in development, immunity and cancer[J]. Nat Rev Mol Cell Biol, 2018, 19(7): 419-435.
2	JIANG J M, NG H H. TGFβ and SMADs talk to NANOG in human embryonic stem cells[J]. Cell Stem Cell, 2008, 3(2): 127-128.
3	OSNATO A, BROWN S, KRUEGER C, et al. TGFβ signalling is required to maintain pluripotency of human naïve pluripotent stem cells[J]. Elife, 2021, 10: e67259.
4	XU R H, SAMPSELL-BARRON T L, GU F, et al. NANOG is a direct target of TGFβ/activin-mediated SMAD signaling in human ESCs[J]. Cell Stem Cell, 2008, 3(2): 196-206.
5	VALLIER L, MENDJAN S, BROWN S, et al. Activin/Nodal signalling maintains pluripotency by controlling Nanog expression[J]. Development, 2009, 136(8): 1339-1349.
6	WATABE T, MIYAZONO K. Roles of TGF-β family signaling in stem cell renewal and differentiation[J]. Cell Res, 2009, 19(1): 103-115.
7	TEO A K K, ARNOLD S J, TROTTER M W B, et al. Pluripotency factors regulate definitive endoderm specification through eomesodermin[J]. Genes Dev, 2011, 25(3): 238-250.
8	YANG J, JIANG W. The role of SMAD2/3 in human embryonic stem cells[J]. Front Cell Dev Biol, 2020, 8: 653.
9	ARAGÓN E, WANG Q, ZOU Y L, et al. Structural basis for distinct roles of SMAD2 and SMAD3 in FOXH1 pioneer-directed TGF-β signaling[J]. Genes Dev, 2019, 33(21/22): 1506-1524.
10	NOMURA M, LI E. Smad2 role in mesoderm formation, left-right patterning and craniofacial development[J]. Nature, 1998, 393(6687): 786-790.
11	WEINSTEIN M, YANG X, LI C, et al. Failure of egg cylinder elongation and mesoderm induction in mouse embryos lacking the tumor suppressor smad2[J]. Proc Natl Acad Sci USA, 1998, 95(16): 9378-9383.
12	ASHCROFT G S, YANG X, GLICK A B, et al. Mice lacking Smad3 show accelerated wound healing and an impaired local inflammatory response[J]. Nat Cell Biol, 1999, 1(5): 260-266.
13	TREMBLAY K D, HOODLESS P A, BIKOFF E K, et al. Formation of the definitive endoderm in mouse is a Smad2-dependent process[J]. Development, 2000, 127(14): 3079-3090.
14	VINCENT S D, DUNN N R, HAYASHI S, et al. Cell fate decisions within the mouse organizer are governed by graded Nodal signals[J]. Genes Dev, 2003, 17(13): 1646-1662.
15	SAKAKI-YUMOTO M, LIU J M, RAMALHO-SANTOS M, et al. Smad2 is essential for maintenance of the human and mouse primed pluripotent stem cell state[J]. J Biol Chem, 2013, 288(25): 18546-18560.
16	LIU L, LIU X, REN X D, et al. Smad2 and Smad3 have differential sensitivity in relaying TGFβ signaling and inversely regulate early lineage specification[J]. Sci Rep, 2016, 6: 21602.
17	GONZÁLEZ F, ZHU Z R, SHI Z D, et al. An iCRISPR platform for rapid, multiplexable, and inducible genome editing in human pluripotent stem cells[J]. Cell Stem Cell, 2014, 15(2): 215-226.
18	SANJANA N E, SHALEM O, ZHANG F. Improved vectors and genome-wide libraries for CRISPR screening[J]. Nat Methods, 2014, 11(8): 783-784.
19	WANG Q, ZOU Y L, NOWOTSCHIN S, et al. The p53 family coordinates Wnt and nodal inputs in mesendodermal differentiation of embryonic stem cells[J]. Cell Stem Cell, 2017, 20(1): 70-86.
20	D'AMOUR K A, AGULNICK A D, ELIAZER S, et al. Efficient differentiation of human embryonic stem cells to definitive endoderm[J]. Nat Biotechnol, 2005, 23(12): 1534-1541.
21	ZHU Z R, LI Q V, LEE K, et al. Genome editing of lineage determinants in human pluripotent stem cells reveals mechanisms of pancreatic development and diabetes[J]. Cell Stem Cell, 2016, 18(6): 755-768.
22	PENG G D, SUO S B, CHEN J, et al. Spatial transcriptome for the molecular annotation of lineage fates and cell identity in mid-gastrula mouse embryo[J]. Dev Cell, 2016, 36(6): 681-697.
23	PETERSEN M, PARDALI E, VAN DER HORST G, et al. Smad2 and Smad3 have opposing roles in breast cancer bone metastasis by differentially affecting tumor angiogenesis[J]. Oncogene, 2010, 29(9): 1351-1361.
24	MALHOTRA N, ROBERTSON E, KANG J. SMAD2 is essential for TGF β-mediated Th17 cell generation[J]. J Biol Chem, 2010, 285(38): 29044-29048.
25	DUNN N R, KOONCE C H, ANDERSON D C, et al. Mice exclusively expressing the short isoform of Smad2 develop normally and are viable and fertile[J]. Genes Dev, 2005, 19(1): 152-163.
26	KIM S W, YOON S J, CHUONG E, et al. Chromatin and transcriptional signatures for Nodal signaling during endoderm formation in hESCs[J]. Dev Biol, 2011, 357(2): 492-504.

[1]	Xiao-zhi SUN, Shuang LI, Ying JIN, Bing LIAO. Effect of enzyme digestion into cell clumps on protein levels of OCT4 and SOX2 in human embryonic stem cells [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(4): 413-420.
[2]	LI Yi-min, TAN Guo-jing, JIANG Yu, ZOU Can, HU Guo-hua, LIU Jie, YANG Yu-cheng. Role of TGF-β1/Smads signaling pathway in tissue remodeling of cultured nasal polyps in vitro [J]. , 2019, 39(7): 737-.
[3]	ZHANG Rong-hua, DONG An-ying, BAI Gan-ping, WAN Ping, JIANG Yi, WU Hong. Effects of connective tissue growth factor gene-silencing on cell growth and cell cycle of hepatic stellate cells [J]. , 2019, 39(12): 1375-.
[4]	ZOU Qi-pa, LING Jing, LIU Chao-dong. Experimental study on inhibition of proliferation of keloid fibroblasts by decitabine [J]. , 2015, 35(2): 210-.
[5]	QIN Kai-xiu, JIAN Hua-gang. Effects of curcumin on expressions of TGF-β1, Smad3, and Smad7 of fibroblasts [J]. , 2015, 35(12): 1814-.
[6]	WANG Song-hao, SHENG Jing, CAI Wen-wei, et al. Effects of TGF-β₁ signal transduction inhibition by antisense-Smad3 adenovirus vector transfection on intimal hyperplasia after balloon injury in rats [J]. , 2010, 30(5): 522-.
[7]	CHENG Zhi-hui, CAI Wen-wei, LU Ping, et al. Effects of signal transduction interruption of transforming growth factor-β₁ by anti-Smad3 on proliferation of vascular smooth muscle cells [J]. , 2009, 29(8): 935-.