Effect of Th17-specific Stat3 knockout on anxiety- and depressive-like behaviors in periodontitis mice

doi:10.3969/j.issn.1674-8115.2025.07.005

Abstract

Abstract:

Objective ·To investigate the effect of Th17 cell-specific Stat3 knockout on anxiety- and depressive-like behaviors. Methods ·Mice with specific Stat3 knockout in Th17 cells (Stat3^fl/fl; Il17a-CreERT2), named Stat3^△^Il17a, and wild-type mice (Stat3^fl/fl, WT) were generated through the Cre/LoxP system, and Stat3 knockout was induced by intraperitoneal injection of tamoxifen. CD4⁺T cells were isolated using magnetic-activated cell sorting and induced to differentiate into Th17 cells. Reverse transcription polymerase chain reaction and Western blotting were used to verify Stat3 knockout efficiency. Mice were assigned into 4 groups: WT-C group, Stat3^△^Il17a -C group, WT-P group, and Stat3^△^Il17a -P group. The periodontitis model was established in the WT-P group and the Stat3^△^Il17a -P group by injection of Porphyromonas gingivalis-lipopolysaccharide (P. gingivalis-LPS) into the gingival sulcus. Behavioral tests, including the open field test, elevated zero maze, and forced swimming test, were conducted to evaluate changes in anxiety- and depressive-like behaviors. Micro-computed tomography was used to observe destruction of alveolar bone. Neuronal injury was observed by H-E staining, and the level of brain-derived neurotrophic factor (BDNF) was detected by enzyme-linked immunosorbent assay. Results ·mRNA expression and protein levels of Stat3 in Stat3^△^Il17a mice were inhibited compared to WT mice (P<0.05). Experimental periodontitis model was successfully established in the WT-P group and the Stat3^△^Il17a -P group. The degree of alveolar bone destruction was reduced in the Stat3^△^Il17a -P group compared to the WT-P group. In the WT-P group, decreased residence time in the central area and in the open area was observed in the open field test and elevated zero maze respectively, and increased immortal time was recorded in the forced swimming test (P<0.05). Moreover, neuronal injury was detected and significantly decreased expression levels of BDNF in the brain were measured in the WT-P group compared with the WT-C group (P<0.05). The degree of abnormal behaviors and neuronal injury was reduced in the Stat3^△^Il17a -P group compared to the WT-P group (P<0.05). Moreover, the level of BDNF in the Stat3^△^Il17a -P was higher than that in the WT-P group (P<0.05). Conclusion ·Periodontitis may contribute to anxiety- and depressive-like behaviors and neuronal damage in mice, while Th17-specific conditional knockout of Stat3 could significantly alleviate pathological behaviors and neuronal damage. Stat3-mediated-Th17 cell immune responses may play a crucial role in the correlation between periodontitis and anxiety and depression.

Key words: periodontitis, anxiety- and depressive-like behavior, Th17 cells, Stat3 gene, conditional gene knockout, neuronal injury

CLC Number:

R781.4

ZHOU Yining, YE Zhiyun, CHEN Huiwen, XIE Xinyi, ZHOU Wei, SONG Zhongchen. Effect of Th17-specific Stat3 knockout on anxiety- and depressive-like behaviors in periodontitis mice[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(7): 838-845.

Figures/Tables 8

Tab 1 Primer sequences for real-time PCR

Primer	Sequence
β-actin	Forward: 5′- GTGACGTTGACATCCGTAAAGA -3′
	Reverse: 5′- GCCGGACTCATCGTACTC -3′
Stat3	Forward: 5′- CTTGGCCCTTTGGAATGAAG -3′
	Reverse: 5′- CAAGTGAAAGTGACCCCTCC -3′

Fig 1 Stat3 mRNA and protein expression levels in Th17 cells of Stat3△Il17a mice

Fig 2 Establishment of periodontitis model in Stat3△Il17a mice

Fig 3 Effects of periodontitis on open field test in Stat3△Il17a mice

Fig 4 Effects of periodontitis on results of elevated zero maze in Stat3△Il17a mice

Fig 5 Effects of periodontitis on results of forced swimming test in Stat3△Il17a mice

Fig 6 Effects of periodontitis on pathological morphology of hippocampal tissue in Stat3△Il17a mice (H-E staining, ×400)

Fig 7 Effect of periodontitis on levels of BDNF in Stat3△Il17a mice

TrendMD

References 30

[1]	SEDGHI L M, BACINO M, KAPILA Y L. Periodontal disease: the good, the bad, and the unknown[J]. Front Cell Infect Microbiol, 2021, 11: 766944.
[2]	HAJISHENGALLIS G. Interconnection of periodontal disease and comorbidities: evidence, mechanisms, and implications[J]. Periodontol 2000, 2022, 89(1): 9-18.
[3]	SZUHANY K L, SIMON N M. Anxiety disorders: a review[J]. JAMA, 2022, 328(24): 2431-2445.
[4]	ARAÚJO M M, MARTINS C C, COSTA L C, et al. Association between depression and periodontitis: a systematic review and meta-analysis[J]. J Clin Periodontol, 2016, 43(3): 216-228.
[5]	DIBELLO V, CUSTODERO C, CAVALCANTI R, et al. Impact of periodontal disease on cognitive disorders, dementia, and depression: a systematic review and meta-analysis[J]. GeroScience, 2024, 46(5): 5133-5169.
[6]	HUANG N, DONG H, LUO Y, et al. Th17 cells in periodontitis and its regulation by A20[J]. Front Immunol, 2021, 12: 742925.
[7]	JIA L, JIANG Y, WU L, et al. Porphyromonas gingivalis aggravates colitis via a gut microbiota-linoleic acid metabolism-Th17/Treg cell balance axis[J]. Nat Commun, 2024, 15(1): 1617.
[8]	SHI Y, WEI B, LI L, et al. Th17 cells and inflammation in neurological disorders: possible mechanisms of action[J]. Front Immunol, 2022, 13: 932152.
[9]	WANG C, ZHOU W, SU G, et al. Progranulin suppressed autoimmune uveitis and autoimmune neuroinflammation by inhibiting Th1/Th17 cells and promoting Treg cells and M2 macrophages[J]. Neurol Neuroimmunol Neuroinflamm, 2022, 9(2): e1133.
[10]	QIN Z, WANG R, HOU P, et al. TCR signaling induces STAT3 phosphorylation to promote TH17 cell differentiation[J]. J Exp Med, 2024, 221(3): e20230683.
[11]	ZHANG X, ZHANG X, QIU C, et al. The imbalance of Th17/Treg via STAT3 activation modulates cognitive impairment in P. gingivalis LPS-induced periodontitis mice[J]. J Leukoc Biol, 2021, 110(3): 511-524.
[12]	LIU K, JIN H W, ZHOU B. Genetic lineage tracing with multiple DNA recombinases: a user′s guide for conducting more precise cell fate mapping studies[J]. J Biol Chem, 2020, 295(19): 6413-6424.
[13]	TAMURA H, MAEKAWA T, HIYOSHI T, et al. Analysis of experimental ligature-induced periodontitis model in mice[J]. Methods Mol Biol, 2021, 2210: 237-250.
[14]	DE MOLON R S, MASCARENHAS V I, DE AVILA E D, et al. Long-term evaluation of oral gavage with periodontopathogens or ligature induction of experimental periodontal disease in mice[J]. Clin Oral Investig, 2016, 20(6): 1203-1216.
[15]	ACQUA Y D, HERNÁNDEZ C, FOGACCI M, et al. Local and systemic effects produced in different models of experimental periodontitis in mice: a systematic review[J]. Arch Oral Biol, 2022, 143: 105528.
[16]	CAO T, TIAN D, WANG S Y, et al. Microglial DBP signaling mediates behavioral abnormality induced by chronic periodontitis in mice[J]. Adv Sci (Weinh), 2024, 11(46): e2406269.
[17]	VAROTTO B L R, MARTINEZ R C R, GOUVEIA F V, et al. Increased anxiety-like behavior in the acute phase of a preclinical model of periodontal disease[J]. Front Neurol, 2020, 11: 598851.
[18]	WESTFALL S, CARACCI F, ZHAO D Y, et al. Microbiota metabolites modulate the T helper 17 to regulatory T cell (Th17/Treg) imbalance promoting resilience to stress-induced anxiety- and depressive-like behaviors[J]. Brain Behav Immun, 2021, 91: 350-368.
[19]	RAMOS A. Animal models of anxiety: do I need multiple tests?[J]. Trends Pharmacol Sci, 2008, 29(10): 493-498.
[20]	CRYAN J F, HOLMES A. The ascent of mouse: advances in modelling human depression and anxiety[J]. Nat Rev Drug Discov, 2005, 4(9): 775-790.
[21]	ZHENG D X, KANG X N, WANG Y X, et al. Periodontal disease and emotional disorders: a meta-analysis[J]. J Clin Periodontol, 2021, 48(2): 180-204.
[22]	WANG J, WANG Y, LI H, et al. Associations between oral health and depression and anxiety: a cross-sectional and prospective cohort study from the UK Biobank[J]. J Clin Periodontol, 2024, 51(11): 1466-1477.
[23]	KOU Y, JIANG Y, LIU S, et al. Regulatory T cells showed characteristics of T helper-17 (Th17) cells in mice periodontitis model[J]. Oral Dis, 2023, 29(3): 1149-1162.
[24]	DAVAMI M H, BAHARLOU R, AHMADI VASMEHJANI A, et al. Elevated IL-17 and TGF-β serum levels: a positive correlation between T-helper 17 cell-related pro-inflammatory responses with major depressive disorder[J]. Basic Clin Neurosci, 2016, 7(2): 137-142.
[25]	BEUREL E, HARRINGTON L E, JOPE R S. Inflammatory T helper 17 cells promote depression-like behavior in mice[J]. Biol Psychiatry, 2013, 73(7): 622-630.
[26]	KUBICK N, FLOURNOY P C H, ENCIU A M, et al. Drugs modulating CD4⁺ T cells blood-brain barrier interaction in Alzheimer′s disease[J]. Pharmaceutics, 2020, 12(9): E880.
[27]	GARCÍA-GUTIÉRREZ M S, NAVARRO D, TORREGROSA A B, et al. Alterations of BDNF, mGluR5, Homer1a, p11 and excitatory/inhibitory balance in corticolimbic brain regions of suicide decedents[J]. J Affect Disord, 2023, 339: 366-376.
[28]	CHEN Z W, GU J P, LIN S S, et al. Saffron essential oil ameliorates CUMS-induced depression-like behavior in mice via the MAPK-CREB1-BDNF signaling pathway[J]. J Ethnopharmacol, 2023, 300: 115719.
[29]	DING H, CHEN J, SU M, et al. BDNF promotes activation of astrocytes and microglia contributing to neuroinflammation and mechanical allodynia in cyclophosphamide-induced cystitis[J]. J Neuroinflammation, 2020, 17(1): 19.
[30]	XIU M H, WANG D M, DU X D, et al. Interaction of BDNF and cytokines in executive dysfunction in patients with chronic schizophrenia[J]. Psychoneuroendocrinology, 2019, 108: 110-117.