Mechanisms of Basigin regulation in hemoglobin-induced cardiomyocyte ferroptosis

doi:10.3969/j.issn.1674-8115.2025.12.001

Abstract

Abstract:

Objective ·To investigate the mechanism of hemoglobin (Hb)-induced cardiomyocyte injury and the regulatory role of Basigin (BSG) in this process. Methods ·An in vitro model was established by treating H9c2 cardiomyocytes with different concentrations of Hb (0, 7.5, 15.0, and 30.0 μmol/L); cell viability and mortality were detected using the WST-1 assay and flow cytometry. Subsequently, H9c2 cardiomyocytes underwent hypoxia/reoxygenation treatment with low-concentration gradients of Hb (0, 2.5, 5.0, and 7.5 μmol/L) to simulate the pathological microenvironment of ischemia-reperfusion injury, further validating Hb's toxic effects on cardiomyocytes. Multiple cell death inhibitors were used, including a necroptosis inhibitor (necrostatin-1, Nec-1), an autophagy inhibitor (3-methyladenine, 3-MA), a ferroptosis inhibitor (ferrostatin-1, Fer-1), and a pyroptosis inhibitor (VX-765), to investigate the mechanism of Hb-induced cardiomyocyte injury. Bsg mRNA and protein levels were detected by Western blotting and real-time quantitative PCR. Bsg expression was knocked down in H9c2 cardiomyocytes using siRNA; the role of BSG in Hb-induced cardiomyocyte injury and ferroptosis was then verified by the WST-1 assay and flow cytometry. Results ·Under both normoxic and hypoxia/reoxygenation conditions, Hb showed direct toxic effects on H9c2 cardiomyocytes in a concentration-dependent manner. Further investigation showed that, compared with other cell death inhibitors, the ferroptosis inhibitor Fer-1 more significantly alleviated Hb-induced cardiomyocyte injury. Western blotting and real-time quantitative PCR results demonstrated that compared with the control group, Bsg mRNA and protein expression levels were significantly increased in Hb-treated H9c2 cardiomyocytes. Knockdown of Bsg expression decreased the mRNA expression of the ferroptosis marker prostaglandin-endoperoxide synthase 2 (Ptgs2) and alleviated Hb-induced cardiomyocyte injury and death. Conclusion ·Hb may induce myocardial injury by promoting cardiomyocyte ferroptosis; BSG plays a role in this process, and inhibition of its expression can counteract Hb-induced ferroptosis and cardiomyocyte injury.

Key words: intramyocardial hemorrhage, ischemia-reperfusion injury, hemoglobin (Hb), cardiomyocyte, ferroptosis, Basigin (BSG)

CLC Number:

R542.2

LI Wenli, ZHONG Fangyuan, ZHAO Yichao, JIN Lixing, LEI Jie, SHI Yao, PU Jun, GE Heng. Mechanisms of Basigin regulation in hemoglobin-induced cardiomyocyte ferroptosis[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(12): 1559-1567.

Figures/Tables 7

Tab 1 Sequences of siRNA （5'→3'）

siRNA	Forward	Reverse
si-NC	UUCUCCGAACGUGUCACGUdTdT	ACGUGACACGUUCGGAGAAdTdT
si-Bsg	GAUCAAGGUGGGAAAGAAtt	UUUCUUUCCCACCUUGAUCtt

Tab 2 Primer sequences for real-time quantitative PCR （5′→3′）

Gene	Forward primer	Reverse primer
Ptgs2	TTCCTCCTGTGGCTGATGACTG	AGGTCCTCGCTTCTGATCTGTC
Bsg	GCATCTTCCTTCCTGAGCCTGTG	TGGCGTGTTCCGATTTCTTTCCC
β-actin	CACTATCGGCAATGAGCGGTTC	CAGCACTGTGTTGGCATAGAGG

Fig 1 H9c2 cardiomyocyte injury induced by Hb in a concentration-dependent manner

Fig 2 Hypoxia-induced H9c2 cardiomyocyte injury exacerbated by Hb

Fig 3 Effect of the ferroptosis inhibitor on Hb-induced H9c2 cardiomyocyte injury

Fig 4 Hb-induced changes in BSG expression in H9c2 cardiomyocytes

Fig 5 Effects of knocking down Bsg on Hb-induced H9c2 cardiomyocyte injury

TrendMD

References 34

[1]	DAMLUJI A A, VAN DIEPEN S, KATZ J N, et al. Mechanical complications of acute myocardial infarction: a scientific statement from the American Heart Association[J]. Circulation, 2021, 144(2): e16-e35.
[2]	ZEYMER U, LUDMAN P, DANCHIN N, et al. Reperfusion therapies and in-hospital outcomes for ST-elevation myocardial infarction in Europe: the ACVC-EAPCI EORP STEMI Registry of the European Society of Cardiology[J]. Eur Heart J, 2021, 42(44): 4536-4549.
[3]	EZEKOWITZ J A, KAUL P, BAKAL J A, et al. Declining in-hospital mortality and increasing heart failure incidence in elderly patients with first myocardial infarction[J]. J Am Coll Cardiol, 2009, 53(1): 13-20.
[4]	DOCHERTY K F, JACKSON A M, MACARTNEY M, et al. Declining risk of heart failure hospitalization following first acute myocardial infarction in Scotland between 1991‒2016[J]. Eur J Heart Fail, 2023, 25(8): 1213-1224.
[5]	BULLUCK H, ROSMINI S, ABDEL-GADIR A, et al. Residual myocardial iron following intramyocardial hemorrhage during the convalescent phase of reperfused ST-segment-elevation myocardial infarction and adverse left ventricular remodeling[J]. Circ Cardiovasc Imaging, 2016, 9(10): e004940.
[6]	D'ENTREMONT M A, ALAZZONI A, DZAVIK V, et al. No-reflow after primary percutaneous coronary intervention in patients with ST-elevation myocardial infarction: an angiographic core laboratory analysis of the TOTAL Trial[J]. EuroIntervention, 2023, 19(5): e394-e401.
[7]	LECHNER I, REINDL M, STIERMAIER T, et al. Clinical outcomes associated with various microvascular injury patterns identified by CMR after STEMI[J]. J Am Coll Cardiol, 2024, 83(21): 2052-2062.
[8]	VORA K P, KUMAR A, KRISHNAM M S, et al. Microvascular obstruction and intramyocardial hemorrhage in reperfused myocardial infarctions: pathophysiology and clinical insights from imaging[J]. JACC Cardiovasc Imaging, 2024, 17(7): 795-810.
[9]	LIU T, HOWARTH A G, CHEN Y Y, et al. Intramyocardial hemorrhage and the "wave front" of reperfusion injury compromising myocardial salvage[J]. J Am Coll Cardiol, 2022, 79(1): 35-48.
[10]	LIU Y, QI L X, LI Z, et al. Crosstalk between matrix metalloproteinases and their inducer EMMPRIN/CD147: a promising therapeutic target for intracerebral hemorrhage[J]. Transl Stroke Res, 2025, 16(2): 557-567.
[11]	SEIZER P, OCHMANN C, SCHÖNBERGER T, et al. Disrupting the EMMPRIN (CD147)-cyclophilin A interaction reduces infarct size and preserves systolic function after myocardial ischemia and reperfusion[J]. Arterioscler Thromb Vasc Biol, 2011, 31(6): 1377-1386.
[12]	REDDY V S, PRABHU S D, MUMMIDI S, et al. Interleukin-18 induces EMMPRIN expression in primary cardiomyocytes via JNK/Sp1 signaling and MMP-9 in part via EMMPRIN and through AP-1 and NF-κB activation[J]. Am J Physiol Heart Circ Physiol, 2010, 299(4): H1242-H1254.
[13]	SUZUKI K, SATOH K, IKEDA S, et al. Basigin promotes cardiac fibrosis and failure in response to chronic pressure overload in mice[J]. Arterioscler Thromb Vasc Biol, 2016, 36(4): 636-646.
[14]	YOON Y W, KWON H M, HWANG K C, et al. Upstream regulation of matrix metalloproteinase by EMMPRIN; extracellular matrix metalloproteinase inducer in advanced atherosclerotic plaque[J]. Atherosclerosis, 2005, 180(1): 37-44.
[15]	TIMMERS L, PASTERKAMP G, DE HOOG V C, et al. The innate immune response in reperfused myocardium[J]. Cardiovasc Res, 2012, 94(2): 276-283.
[16]	VYAS R, CHANGAL K H, BHUTA S, et al. Impact of intramyocardial hemorrhage on clinical outcomes in ST-elevation myocardial infarction: a systematic review and meta-analysis[J]. J Soc Cardiovasc Angiogr Interv, 2022, 1(6): 100444.
[17]	BETGEM R P, DE WAARD G A, NIJVELDT R, et al. Intramyocardial haemorrhage after acute myocardial infarction[J]. Nat Rev Cardiol, 2015, 12(3): 156-167.
[18]	CHEN Y F, LI X T, WANG S Y, et al. Targeting iron metabolism and ferroptosis as novel therapeutic approaches in cardiovascular diseases[J]. Nutrients, 2023, 15(3): 591.
[19]	FAN X B, LI A L, YAN Z P, et al. From iron metabolism to ferroptosis: pathologic changes in coronary heart disease[J]. Oxid Med Cell Longev, 2022, 2022: 6291889.
[20]	COKIC I, CHAN S F, GUAN X M, et al. Intramyocardial hemorrhage drives fatty degeneration of infarcted myocardium[J]. Nat Commun, 2022, 13(1): 6394.
[21]	CHEN R D, ZHANG Y Q, ZHANG H R, et al. SGLT2 inhibitor dapagliflozin alleviates intramyocardial hemorrhage and adverse ventricular remodeling via suppressing hepcidin in myocardial ischemia-reperfusion injury[J]. Eur J Pharmacol, 2023, 950: 175729.
[22]	REINSTADLER S J, STIERMAIER T, REINDL M, et al. Intramyocardial haemorrhage and prognosis after ST-elevation myocardial infarction[J]. Eur Heart J Cardiovasc Imaging, 2019, 20(2): 138-146.
[23]	JIANG X J, STOCKWELL B R, CONRAD M. Ferroptosis: mechanisms, biology and role in disease[J]. Nat Rev Mol Cell Biol, 2021, 22(4): 266-282.
[24]	LI J Y, LIU S Q, YAO R Q, et al. A novel insight into the fate of cardiomyocytes in ischemia-reperfusion injury: from iron metabolism to ferroptosis[J]. Front Cell Dev Biol, 2021, 9: 799499.
[25]	MA J D, ZHANG H Q, CHEN Y F, et al. The role of macrophage iron overload and ferroptosis in atherosclerosis[J]. Biomolecules, 2022, 12(11): 1702.
[26]	BEHROUZI B, WEYERS J J, QI X L, et al. Action of iron chelator on intramyocardial hemorrhage and cardiac remodeling following acute myocardial infarction[J]. Basic Res Cardiol, 2020, 115(3): 24.
[27]	WU J, CHEN L, QIN C, et al. CD147 contributes to SARS-CoV-2-induced pulmonary fibrosis[J]. Signal Transduct Target Ther, 2022, 7(1): 382.
[28]	LV J J, WANG H, ZHANG C, et al. CD147 sparks atherosclerosis by driving M1 phenotype and impairing efferocytosis[J]. Circ Res, 2024, 134(2): 165-185.
[29]	LIU Y, BAI Q, YONG V W, et al. EMMPRIN promotes the expression of MMP-9 and exacerbates neurological dysfunction in a mouse model of intracerebral hemorrhage[J]. Neurochem Res, 2022, 47(8): 2383-2395.
[30]	BIAN H J, CHEN L, ZHANG Z, et al. Meplazumab, a CD147 antibody, for severe COVID-19: a double-blind, randomized, placebo-controlled, phase 3 clinical trial[J]. Signal Transduct Target Ther, 2025, 10(1): 119.
[31]	ZHANG H, YANG X M, XUE Y, et al. A basigin antibody modulates MCTs to impact tumor metabolism and immunity[J]. Cell Discov, 2025, 11(1): 44.
[32]	WANG R F, ZONG K X, SONG J, et al. Inhibitor of CD147 suppresses T cell activation and recruitment in CVB3-induced acute viral myocarditis[J]. Viruses, 2023, 15(5): 1137.
[33]	YUAN S Q, WANG L P, CHEN X X, et al. Triptolide inhibits the migration and invasion of human prostate cancer cells via Caveolin-1/CD147/MMPs pathway[J]. Biomed Pharmacother, 2016, 84: 1776-1782.
[34]	ZHOU J, LI S Z, YANG Y T, et al. Triptolide alleviates acute lung injury by reducing mitochondrial dysfunction mediated ferroptosis through the STAT3/P53 pathway[J]. Free Radic Biol Med, 2025, 230: 79-94.