
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2026, Vol. 46 ›› Issue (4): 451-466.doi: 10.3969/j.issn.1674-8115.2026.04.005
• Basic research • Previous Articles
Peng Qianqian, Song Jinghan, Xu Xingyi, Xiao Hui(
)
Received:2025-09-25
Accepted:2025-12-23
Online:2026-04-15
Published:2026-04-15
Contact:
Xiao Hui
E-mail:xiaohui771210@163.com
Supported by:CLC Number:
Peng Qianqian, Song Jinghan, Xu Xingyi, Xiao Hui. Bioinformatic analysis and validation of the RNA-binding protein HuR promoting non-small cell lung cancer progression via ITGB1[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(4): 451-466.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2026.04.005
| TCGA | Detail | Tumor/n | Normal/n | GTEx | Normal/n |
|---|---|---|---|---|---|
| ACC | Adrenocortical carcinoma | 79 | ‒ | Adrenal gland | 128 |
| BLCA | Bladder urothelial carcinoma | 408 | 19 | Bladder | 9 |
| BRCA | Breast invasive carcinoma | 1 093 | 112 | Breast | 179 |
| CESC | Cervical squamous cell carcinoma and endocervical adenocarcinoma | 304 | 3 | Cervix uteri | 10 |
| CHOL | Cholangio carcinoma | 36 | 9 | ‒ | ‒ |
| COAD | Colon adenocarcinoma | 457 | 41 | Colon | 308 |
| DLBC | Lymphoid neoplasm diffuse large B-cell lymphoma | 48 | ‒ | Blood | 337 |
| ESCA | Esophageal carcinoma | 184 | 11 | Esophagus | 273 |
| GBM | Glioblastoma multiforme | 153 | 5 | Brain | 207 |
| HNSC | Head and neck squamous cell carcinoma | 520 | 44 | ‒ | ‒ |
| KICH | Kidney chromophobe | 66 | 25 | Kidney | 28 |
| KIRC | Kidney renal clear cell carcinoma | 533 | 72 | Kidney | 28 |
| KIRP | Kidney renal papillary cell carcinoma | 290 | 32 | Kidney | 28 |
| LAML | Acute myeloid leukemia | 173 | ‒ | Bone marrow | 70 |
| LGG | Brain lower grade glioma | 516 | ‒ | Brain | 207 |
| LIHC | Liver hepatocellular carcinoma | 371 | 50 | Liver | 110 |
| LUAD | Lung adenocarcinoma | 515 | 59 | Lung | 288 |
| LUSC | Lung squamous cell carcinoma | 501 | 50 | Lung | 288 |
| MESO | Mesothelioma | 87 | ‒ | ‒ | ‒ |
| OV | Ovarian serous cystadenocarcinoma | 303 | ‒ | Ovary | 88 |
| PAAD | Pancreatic adenocarcinoma | 178 | 4 | Pancreas | 167 |
| PCPG | Pheochromocytoma and paraganglioma | 179 | 3 | ‒ | ‒ |
| PRAD | Prostate adenocarcinoma | 497 | 52 | Prostate | 100 |
| READ | Rectum adenocarcinoma | 166 | 10 | Colon | 308 |
| SARC | Sarcoma | 259 | 2 | ‒ | ‒ |
| SKCM | Skin cutaneous melanoma | 103 | ‒ | Skin | 557 |
| STAD | Stomach adenocarcinoma | 415 | 35 | Stomach | 175 |
| TGCT | Testicular germ cell tumor | 150 | ‒ | Testis | 165 |
| THCA | Thyroid carcinoma | 501 | 59 | Thyroid | 278 |
| THYM | Thymoma | 120 | ‒ | Blood | 337 |
| UCEC | Uterine corpus endometrial carcinoma | 545 | 35 | Uterus | 78 |
| UCS | Uterine carcinosarcoma | 57 | ‒ | Uterus | 78 |
| UVM | Uveal melanoma | 80 | ‒ | ‒ | ‒ |
| Total | 9 887 | 732 | 3 555 |
Tab 1 Sample counts of tumor and normal tissues from TCGA and GTEx datasets
| TCGA | Detail | Tumor/n | Normal/n | GTEx | Normal/n |
|---|---|---|---|---|---|
| ACC | Adrenocortical carcinoma | 79 | ‒ | Adrenal gland | 128 |
| BLCA | Bladder urothelial carcinoma | 408 | 19 | Bladder | 9 |
| BRCA | Breast invasive carcinoma | 1 093 | 112 | Breast | 179 |
| CESC | Cervical squamous cell carcinoma and endocervical adenocarcinoma | 304 | 3 | Cervix uteri | 10 |
| CHOL | Cholangio carcinoma | 36 | 9 | ‒ | ‒ |
| COAD | Colon adenocarcinoma | 457 | 41 | Colon | 308 |
| DLBC | Lymphoid neoplasm diffuse large B-cell lymphoma | 48 | ‒ | Blood | 337 |
| ESCA | Esophageal carcinoma | 184 | 11 | Esophagus | 273 |
| GBM | Glioblastoma multiforme | 153 | 5 | Brain | 207 |
| HNSC | Head and neck squamous cell carcinoma | 520 | 44 | ‒ | ‒ |
| KICH | Kidney chromophobe | 66 | 25 | Kidney | 28 |
| KIRC | Kidney renal clear cell carcinoma | 533 | 72 | Kidney | 28 |
| KIRP | Kidney renal papillary cell carcinoma | 290 | 32 | Kidney | 28 |
| LAML | Acute myeloid leukemia | 173 | ‒ | Bone marrow | 70 |
| LGG | Brain lower grade glioma | 516 | ‒ | Brain | 207 |
| LIHC | Liver hepatocellular carcinoma | 371 | 50 | Liver | 110 |
| LUAD | Lung adenocarcinoma | 515 | 59 | Lung | 288 |
| LUSC | Lung squamous cell carcinoma | 501 | 50 | Lung | 288 |
| MESO | Mesothelioma | 87 | ‒ | ‒ | ‒ |
| OV | Ovarian serous cystadenocarcinoma | 303 | ‒ | Ovary | 88 |
| PAAD | Pancreatic adenocarcinoma | 178 | 4 | Pancreas | 167 |
| PCPG | Pheochromocytoma and paraganglioma | 179 | 3 | ‒ | ‒ |
| PRAD | Prostate adenocarcinoma | 497 | 52 | Prostate | 100 |
| READ | Rectum adenocarcinoma | 166 | 10 | Colon | 308 |
| SARC | Sarcoma | 259 | 2 | ‒ | ‒ |
| SKCM | Skin cutaneous melanoma | 103 | ‒ | Skin | 557 |
| STAD | Stomach adenocarcinoma | 415 | 35 | Stomach | 175 |
| TGCT | Testicular germ cell tumor | 150 | ‒ | Testis | 165 |
| THCA | Thyroid carcinoma | 501 | 59 | Thyroid | 278 |
| THYM | Thymoma | 120 | ‒ | Blood | 337 |
| UCEC | Uterine corpus endometrial carcinoma | 545 | 35 | Uterus | 78 |
| UCS | Uterine carcinosarcoma | 57 | ‒ | Uterus | 78 |
| UVM | Uveal melanoma | 80 | ‒ | ‒ | ‒ |
| Total | 9 887 | 732 | 3 555 |
| CPTAC | Detail | Tumor/n | Normal/n |
|---|---|---|---|
| BRCA | Breast cancer | 126 | 18 |
| CCRCC | Clear cell renal cell carcinoma | 117 | 84 |
| COAD | Colon adenocarcinoma | 101 | 96 |
| GBM | Glioblastoma | 156 | 5 |
| HNSC | Head and neck squamous cell carcinoma | 110 | 68 |
| NSCLC | Non-small cell lung cancer | 217 | 199 |
| OV | Ovarian serous cystadenocarcinoma | 93 | 10 |
| UCEC | Uterine corpus endometrial carcinoma | 104 | 30 |
| PAAD | Pancreatic adenocarcinoma | 137 | 74 |
| LIHC | Liver hepatocellular carcinoma | 128 | 106 |
| Total | 1 289 | 690 |
Tab 2 Sample counts of tumor and matched normal tissues from the CPTAC dataset
| CPTAC | Detail | Tumor/n | Normal/n |
|---|---|---|---|
| BRCA | Breast cancer | 126 | 18 |
| CCRCC | Clear cell renal cell carcinoma | 117 | 84 |
| COAD | Colon adenocarcinoma | 101 | 96 |
| GBM | Glioblastoma | 156 | 5 |
| HNSC | Head and neck squamous cell carcinoma | 110 | 68 |
| NSCLC | Non-small cell lung cancer | 217 | 199 |
| OV | Ovarian serous cystadenocarcinoma | 93 | 10 |
| UCEC | Uterine corpus endometrial carcinoma | 104 | 30 |
| PAAD | Pancreatic adenocarcinoma | 137 | 74 |
| LIHC | Liver hepatocellular carcinoma | 128 | 106 |
| Total | 1 289 | 690 |
| Gene | Forward (5'→3') | Reverse (5'→3') |
|---|---|---|
| HuR | TAATCGCCATAGCCTTCCTAA | GGCGTCTGCAAATGGTTGTA |
| β-actin | ATCAAGATCATTGCTCCTCCTGAG | CTGCTTGCTGATCCACATCTG |
| ITGB1 | ATCCCAGAGGCTCCAAGAT | CCCCTGATCTTAATCGCAA |
Tab 3 Primer sequences for RT-qPCR
| Gene | Forward (5'→3') | Reverse (5'→3') |
|---|---|---|
| HuR | TAATCGCCATAGCCTTCCTAA | GGCGTCTGCAAATGGTTGTA |
| β-actin | ATCAAGATCATTGCTCCTCCTGAG | CTGCTTGCTGATCCACATCTG |
| ITGB1 | ATCCCAGAGGCTCCAAGAT | CCCCTGATCTTAATCGCAA |
| [1] | Kuang Z Y, Wang J X, Liu K X, et al. Global, regional, and national burden of tracheal, bronchus, and lung cancer and its risk factors from 1990 to 2021: findings from the global burden of disease study 2021[J]. EClinicalMedicine, 2024, 75: 102804. |
| [2] | Sung H, Ferlay J, Siegel R L, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-249. |
| [3] | Wu X Q, Xu L. The RNA-binding protein HuR in human cancer: a friend or foe [J]. Adv Drug Deliv Rev, 2022, 184: 114179. |
| [4] | Sidali A, Teotia V, Solaiman N S, et al. AU-rich element RNA binding proteins: at the crossroads of post-transcriptional regulation and genome integrity[J]. Int J Mol Sci, 2021, 23(1): 96. |
| [5] | Clark M E, Farinha A, Morrison A R, et al. Structural, biological, and biomedical implications of mRNA interactions with the master regulator HuR[J]. NAR Mol Med, 2025, 2(1): ugaf002. |
| [6] | Yadav V, Singh T, Sharma D, et al. Unraveling the regulatory role of HuR/microRNA axis in colorectal cancer tumorigenesis[J]. Cancers, 2024, 16(18): 3183. |
| [7] | Kassabri L, Benhamou R I. Druglike molecular degraders of the oncogenic RNA-binding protein HuR[J]. JACS Au, 2025, 5(8): 3879-3891. |
| [8] | Raguraman R, Shanmugarama S, Mehta M, et al. Drug delivery approaches for HuR-targeted therapy for lung cancer[J]. Adv Drug Deliv Rev, 2022, 180: 114068. |
| [9] | Shatat A S, Mahgoup E M, Rashed M H, et al. Molecular mechanisms of extracellular-ATP-mediated colorectal cancer progression: implication of purinergic receptors-mediated nucleocytoplasmic shuttling of HuR[J]. Purinergic Signal, 2024, 20(6): 669-680. |
| [10] | Finan J M, Guo Y F, Bartlett A Q, et al. HuR-regulated extracellular vesicles promote endothelial cell remodeling in pancreatic cancer[J]. Cancer Res Commun, 2025, 5(9): 1501-1515. |
| [11] | Peng J, Quan J C, Wang X R. Integrated pan-cancer analysis of RNA binding protein HuR investigates its biomarker potential in prognosis, immunotherapy, and drug sensitivity[J]. PLoS Comput Biol, 2025, 21(8): e1013374. |
| [12] | Meng L J, Wu H T, Wu J X, et al. Aberrant CircTMEM45A facilitates inflammatory progression of esophageal squamous cell carcinoma through m5C-mediated NLRP3 activation[J]. Cancer Res, 2025, 85(14): 2694-2713. |
| [13] | Sun L, Guo S W, Xie Y P, et al. The characteristics and the multiple functions of integrin β1 in human cancers[J]. J Transl Med, 2023, 21(1): 787. |
| [14] | Huang Q L, Wang J, Ning H J, et al. Integrin β1 in breast cancer: mechanisms of progression and therapy[J]. Breast Cancer, 2025, 32(1): 43-59. |
| [15] | Lee J H, Son S, Ko Y, et al. Nidogen-1 suppresses cell proliferation, migration, and glycolysis via integrin β1-mediated HIF-1α downregulation in triple-negative breast cancer[J]. Sci Rep, 2025, 15(1): 10633. |
| [16] | Ren R M, Zhang S, Peng Z, et al. Matrix stiffness regulates glucose-6-phosphate dehydrogenase expression to mediate sorafenib resistance in hepatocellular carcinoma through the ITGB1-PI3K/AKT pathway[J]. Cell Death Dis, 2025, 16(1): 538. |
| [17] | Su C, Mo J, Dong S L, et al. Integrinβ-1 in disorders and cancers: molecular mechanisms and therapeutic targets[J]. Cell Commun Signal, 2024, 22(1): 71. |
| [18] | Ye X, Fu Q, Xiao H. The role of RNA-binding protein HuR in lung cancer by RNA sequencing analysis[J]. Front Genet, 2022, 13: 813268. |
| [19] | Zhou X, Han J S, Zuo A N, et al. THBS2+ cancer-associated fibroblasts promote EMT leading to oxaliplatin resistance via COL8A1-mediated PI3K/AKT activation in colorectal cancer[J]. Mol Cancer, 2024, 23(1): 282. |
| [20] | Lu Y B, Chen Q Z, Zhu S, et al. Hypoxia promotes immune escape of pancreatic cancer cells by lncRNA NNT-AS1/METTL3-HuR-mediated ITGB1 m6A modification[J]. Exp Cell Res, 2023, 432(2): 113764. |
| [21] | Liu J X, Tang L, Chu W Z, et al. Cellular retinoic acid binding protein 2 (CRABP2), up-regulated by HPV E6/E7, leads to aberrant activation of the integrin β1/FAK/ERK signaling pathway and aggravates the malignant phenotypes of cervical cancer[J]. Biochem Genet, 2024, 62(4): 2686-2701. |
| [1] | CHEN Jiaying, CHU Yimin, PENG Haixia. Study on prediction model and influencing factors of progression-free survival in colorectal cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(3): 324-334. |
| [2] | ZHANG Xianzhou, DU Fenglin, WU Lei, REN Yizhe, ZHAO Mingna, LOU Jiatao. Mechanistic study of OGT-promoted non-small cell lung cancer proliferation via the ERK signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1288-1297. |
| [3] | LIU Chenxi, HAN Lin, YANG Yi, ZHOU Han, LIU Yayun, SHENG Deqiao. GPR87 promotes invasion and migration through the RHO/ROCK pathway in non-small cell lung cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(12): 1514-1525. |
| [4] | HUANG Huayan, XU-ZHANG Wendi, XIA Liliang, YU Yongfeng, LU Shun. Advances in immunotherapy of advanced non-small cell lung cancer with EGFR mutation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 611-618. |
| [5] | ZHAO Zhuoming, LIU Zhenhao, LU Manman, ZHANG Yu, XU Linfeng, XIE Lu. Analysis of tumor-related features of non-small cell lung cancer based on TCR repertoire workflow [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1520-1528. |
| [6] | LIAO Yahui, LIU Liyun, ZHU Hongrui, LIN Houwen, YAN Jizhou, SUN Fan. Marine sponge-derived smenospongine overcomes resistance of cisplatin via inhibiting EGFR-Akt-ABCG2 pathway in NSCLC cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 997-1007. |
| [7] | LIU Ziyang, WANG Xiaowen, CHEN Li. lncRNA GK-IT1 influences the carcinogenesis of non-small cell lung cancer cells through regulating aldolase A [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 591-601. |
| [8] | XIA Kunjian, DENG Linlin, WANG Lin. Construction and evaluation of a prediction model for liver injury induced by chemotherapy for breast cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(4): 502-509. |
| [9] | LI Ruonan, CHEN Xiaoke, XU Yuanyuan, TAN Qiang. Advances in postoperative adjuvant targeted therapy for patients with stage ⅠB-ⅢA non-small cell lung cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(11): 1612-1619. |
| [10] | Jianru WANG, Guangcao PENG, Mingjun ZHU. Screening potential hub genes associated with myocardial ischemia-reperfusion injury in mice based on GEO database and bioinformatics analysis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 51-62. |
| [11] | Li LIU, Zi-long GENG, Jia-huan CHEN, Sha-sha ZHANG, Bing ZHANG. Whole gene expression profile analysis of miRNAs in human umbilical vein endothelial cells regulated by vascular endothelial growth factor A [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(9): 1183-1189. |
| [12] | Yun-fang MA, Li-na PAN, Zhen LI, Bei-li GAO, Jia-an HU, Zhi-hong XU. Exploratory study on downregulation of PD-L1 in KRAS G12V-mutant non-small cell lung cancer cells by selumetinib [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 741-748. |
| [13] | Rui-jie GENG, Lin YAO, Xin-xin HUANG, Shun-ying YU, Cheng-mei YUAN, Wu HONG, Qin-yu LÜ, Qing-zhong WANG, Zheng-hui YI, Yi-ru FANG. Identification of differentially expressed gene modules in major depressive disorder based on weighted gene co-expression network analysis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 724-731. |
| [14] | WU Jia-yue, JIANG Meng, LIN Si-han, DI Wen. Establishment and validation of predictive model of pregnancy loss in patients with systemic lupus erythematosus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(7): 908-914. |
| [15] | CHEN Si, LIU Chun-liang, ZHAO Qian, SUN Hai-peng, LIU Yun-xia. Identification of hub genes and key pathways in breast cancersurvival-based bioinformatics analysis [J]. , 2020, 40(3): 294-. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||