Establishment and evaluation of various in vitro screening systems for peptide inhibitors targeting SAE1 and SAE2 interaction

doi:10.3969/j.issn.1674-8115.2024.05.004

Abstract

Abstract:

Objective ·To establish various in vitro screening systems for the discovery of peptide inhibitors targeting the interaction between small ubiquitin-like modifier (SUMO)-activating enzyme subunit 1 (SAE1) and subunit 2 (SAE2), as well as to evaluate their advantages, disadvantages, and applicability to this research. Methods ·The DNA fragments encoding human SAE1 and SAE2 were cloned into vector pET-28a, respectively, to generate protein SAE1 and SAE2. Purified proteins were used to establish screening assays, including isothermal calorimetry (ITC), fluorescence polarization (FP), surface plasmon resonance (SPR) and a fluorescence assay based on the SAE enzyme activity. The inhibitory activity of peptide candidates in different screening systems was examined, and their performance in terms of sensitivity, robustness, throughput and cost was evaluated. Results ·The dissociation constant (K_d) of in vitro SAE1 and SAE2 interaction was determined to be 0.96 μmol/L by ITC, and PEPT7 was identified as the most potent peptide. However, the tracer of FP, which was derived from PEPT7, was not up to snuff due to its low affinity with SAE2. In the SPR assay, the K_d value (=1.13 μmol/L) of SAE1 and SAE2 interaction was in line with the results from ITC. The SAE enzyme activity-based screening assay revealed that HP1B, the most effective peptide, inhibited SAE with an half-maximal inhibitory concentration (IC₅₀) of 15.72 μmol/L. The affinity of HP1B for SAE1 was determined to be 34.4 μmol/L by SPR. Conclusion ·Several common screening systems for protein-protein interation (PPI) inhibitors are established and compared. Among them, ITC does not allow for high-throughput screening and it is difficult to accurately evaluate the low-affinity polypeptides with insignificant binding heat. The feasibility of FP relies heavily on the strong affinity between a tracer peptide and the protein target, making it unsuitable for the screening and optimization of low-affinity peptides. SPR is highly sensitive but the cost is high. The SAE enzyme activity-based assay stands out because it is a combination of high sensitivity, robustness, throughput and acceptable cost.

Key words: SUMO-activating enzyme subunit 1 (SAE1), SUMO-activating enzyme subunit 2 (SAE2), peptide inhibitor, drug screening, isothermal calorimetry (ITC), fluorescence polarization (FP), surface plasmon resonance (SPR), enzyme activity-based fluorescence assay

CLC Number:

R363.1

HU Chenyang, LU Shaoyong, YANG Xiuyan. Establishment and evaluation of various in vitro screening systems for peptide inhibitors targeting SAE1 and SAE2 interaction[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(5): 567-575.

Figures/Tables 7

TrendMD

References 19

1	CAPPADOCIA L, LIMA C D. Ubiquitin-like protein conjugation: structures, chemistry, and mechanism[J]. Chem Rev, 2018, 118(3): 889-918.
2	HE X Y, RICEBERG J, SOUCY T, et al. Probing the roles of SUMOylation in cancer cell biology by using a selective SAE inhibitor[J]. Nat Chem Biol, 2017, 13(11): 1164-1171.
3	SEELER J S, DEJEAN A. SUMO and the robustness of cancer[J]. Nat Rev Cancer, 2017, 17(3): 184-197.
4	KROONEN J S, VERTEGAAL A C O. Targeting SUMO signaling to wrestle cancer[J]. Trends Cancer, 2021, 7(6): 496-510.
5	FLOTHO A, MELCHIOR F. Sumoylation: a regulatory protein modification in health and disease[J]. Annu Rev Biochem, 2013, 82: 357-385.
6	KUKKULA A, OJALA V K, MENDEZ L M, et al. Therapeutic potential of targeting the SUMO pathway in cancer[J]. Cancers, 2021, 13(17): 4402.
7	LANGSTON S P, GROSSMAN S, ENGLAND D, et al. Discovery of TAK-981, a first-in-class inhibitor of SUMO-activating enzyme for the treatment of cancer[J]. J Med Chem, 2021, 64(5): 2501-2520.
8	LI Y J, DU L, WANG J H, et al. Allosteric inhibition of ubiquitin-like modifications by a class of inhibitor of SUMO-activating enzyme[J]. Cell Chem Biol, 2019, 26(2): 278-288.e6.
9	FUKUDA I, ITO A, HIRAI G, et al. Ginkgolic acid inhibits protein SUMOylation by blocking formation of the E1-SUMO intermediate[J]. Chem Biol, 2009, 16(2): 133-140.
10	TAKEMOTO M, KAWAMURA Y, HIROHAMA M, et al. Inhibition of protein SUMOylation by davidiin, an ellagitannin from Davidia involucrata[J]. J Antibiot, 2014, 67(4): 335-338.
11	GOEL S, ULAHANNAN S V, OLSZANSKI A J, et al. A phase 1b, multicenter, dose-escalation study of subasumstat (TAK-981) in combination with pembrolizumab in patients (pts) with advanced solid tumors[J]. J Clin Oncol, 2022, 40(16_suppl): 2506.
12	NI D, LI Y, QIU Y R, et al. Combining allosteric and orthosteric drugs to overcome drug resistance[J]. Trends Pharmacol Sci, 2020, 41(5): 336-348.
13	LI S, ZHANG J M, LU S Y, et al. The mechanism of allosteric inhibition of protein tyrosine phosphatase 1B[J]. PLoS One, 2014, 9(5): e97668.
14	LV Z Y, YUAN L M, ATKISON J H, et al. Molecular mechanism of a covalent allosteric inhibitor of SUMO E1 activating enzyme[J]. Nat Commun, 2018, 9(1): 5145.
15	RAN X, GESTWICKI J E. Inhibitors of protein-protein interactions (PPIs): an analysis of scaffold choices and buried surface area[J]. Curr Opin Chem Biol, 2018, 44: 75-86.
16	PIERCE M M, RAMAN C S, NALL B T. Isothermal titration calorimetry of protein-protein interactions[J]. Methods, 1999, 19(2): 213-221.
17	MOERKE N J. Fluorescence polarization (FP) assays for monitoring peptide-protein or nucleic acid-protein binding[J]. Curr Protoc Chem Biol, 2009, 1(1): 1-15.
18	OLSEN S K, CAPILI A D, LU X Q, et al. Active site remodelling accompanies thioester bond formation in the SUMO E1[J]. Nature, 2010, 463(7283): 906-912.
19	WANG J H, CHEN Y. Role of the Zn²⁺ motif of E1 in SUMO adenylation[J]. J Biol Chem, 2010, 285(31): 23732-23738.

Primer	Forward sequence (5′→3′)	Reverse sequence (5′→3′)
SAE1	GCAAATGGGTCGCGGATCCGAATTCATGGTGGAGAAGGAGGAG	GTGGTGCTCGAGTGCGGCCGCATCACTTGGGGCCAAGG
SAE2	GCAAATGGGTCGCGGATCCGAATTCATGGCACTGTCGCG	GTGGTGCTCGAGTGCGGCCGCATCAATCTAATGCTATGAC
SUMO1	GCGCGGCAGCCATATGGCTAGCATGTCTGACCAGGAGGC	GGTGGTGGTGGTGGTGCTCGAGTTAACCCCCCGTTTGTTCC

Primer	Forward sequence (5′→3′)	Reverse sequence (5′→3′)
SAE1	GCAAATGGGTCGCGGATCCGAATTCATGGTGGAGAAGGAGGAG	GTGGTGCTCGAGTGCGGCCGCATCACTTGGGGCCAAGG
SAE2	GCAAATGGGTCGCGGATCCGAATTCATGGCACTGTCGCG	GTGGTGCTCGAGTGCGGCCGCATCAATCTAATGCTATGAC
SUMO1	GCGCGGCAGCCATATGGCTAGCATGTCTGACCAGGAGGC	GGTGGTGGTGGTGGTGCTCGAGTTAACCCCCCGTTTGTTCC

[1]	MEI Yanqing, HAN Yujie, WENG Wenyun, ZHANG Lei, TANG Yujie. In vitro therapeutic effects and molecular mechanisms of targeted inhibition of CDK12/13 in high-grade gliomas [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 545-559.
[2]	RUAN Cong1, ZHONG Jie2, YANG Xiu-yan2, ZHANG Jian2. Design, synthesis and structure-activity relationship study of APC/Asef inhibitors [J]. , 2019, 39(7): 692-.
[3]	QIAN Jin-xing, ZHANG Jian. Structure optimum and biological activity studies of APC/Asef peptide inhibitors [J]. , 2018, 38(10): 1139-.
[4]	JING Bo, CHEN Peng-hui, GAO Xiang, XU Yuan-yuan, WU Yun-zhao, SUN Yun, WU Ying-li . Establishment of cell-based screening system for compound regulating the stability of retinoic acid receptors [J]. , 2017, 37(4): 432-.
[5]	WANG Hui-zi, HAN Bing, GAO Yao-hui, et al. Sensitivity of acs-20;acs-22 double mutant elegans for hypotonic solution and small molecule compounds [J]. , 2013, 33(12): 1591-.
[6]	XU Yuan-yuan, CHEN Peng-hui, WU Ying-li. Research progress of high throughput drug screening models [J]. , 2013, 33(10): 1415-.