Inhibitory effect and mechanism of saikosaponin A on mouse myeloid-derived suppressor cells

doi:10.3969/j.issn.1674-8115.2025.10.007

Abstract

Abstract:

Objective ·To study the regulatory effect of saikosaponin A (SSA) on the differentiation, apoptosis, and immunosuppressive function of myeloid-derived suppressor cells (MDSCs) in mice, and to explore their molecular mechanism. Methods ·Recombinant mouse granulocyte-macrophage colony-stimulating factor (GM-CSF) was used to induce the differentiation of mouse bone marrow cells (BMCs) into MDSCs, or magnetic beads were used to sort MDSCs from tumor-bearing mice. After treating MDSCs with different concentrations (0, 2.5, 5.0 mg/L), flow cytometry (FCM) was used to detect the differentiation and apoptosis of MDSCs, as well as the expression levels of liver X receptor α (LXRα), arginase-1 (Arg-1), and reactive oxygen species (ROS). At the same time, the effects of MDSCs on the proliferation function of T cells, and the effects on the nuclear factor κB (NF-κB), and signal transducer and activator of transcription 1 (STAT1) signaling pathways were also detected. The mRNA levels of LXRα and Arg-1 were detected by quantitative real-time PCR (qPCR). Mice were given SSA by gavage (ig) or intraperitoneal injection (ip), and the mice were sacrificed after administration; and body mass, spleen weight, and spleen index were calculated. FCM was used to detect the proportion of immune cells in the spleen of mice. Results ·SSA could up-regulate the expression level of LXRα in MDSCs, reduce the differentiation of M-MDSCs, induce apoptosis of MDSCs, reduce the expression levels of Arg-1 and ROS in MDSCs, and reduce the inhibitory effect of MDSCs on T cell proliferation. SSA inhibited the phosphorylation levels of NF-κB and STAT1 in MDSCs. The mice treated with SSA by gavage or intraperitoneal injection showed no significant changes in body weight and spleen index. Both modes of administration can reduce the proportion of MDSCs and their subset M-MDSCs in mice, but had different degrees of regulatory effects on other immune cells. Conclusion ·SSA could regulate the differentiation and apoptosis of MDSCs, and inhibit their immunosuppressive function, which may be associated with the up-regulation of LXRα expression, and down-regulation of the NF-κB and STAT1 signaling pathways in MDSCs.

Key words: saikosaponin A (SSA), myeloid-derived suppressor cell (MDSC), immunosuppression, liver X receptor α (LXRα)

CLC Number:

R392

QIN Yahan, SHU Yating, PENG Meiyu. Inhibitory effect and mechanism of saikosaponin A on mouse myeloid-derived suppressor cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1320-1332.

Figures/Tables 8

Tab 1 Primer sequences used in qPCR

Primer name	Primer sequence (5'→3')
GAPDH	F: TGTCTCCTGCGACTTCAACA
	R: GGTGGTCCAGGGTTTCTTACT
ARG-1	F: TGTCCCTAATGACAGCTCCTT
	R: GCATCCACCCAAATGACACAT
NR1H3	F: AAGGGAGCACGCTATGTCTG
	R: TTGCGAAGTCGACACTCCTG

Fig 1 SSA upregulated the expression of LXRα in MDSCs of tumor-bearing mice

Fig 2 Effect of SSA on the differentiation and apoptosis of MDSCs

Fig 3 Immunosuppressive function of SSA in inhibiting MDSCs

Fig 4 Effect of SSA on STAT1 and NF-κB signaling pathways in MDSCs

Fig 5 Effect of SSA on MDSCs and Treg cells in vivo

Fig 6 Effect of SSA on T cells, T cell subsets and B cells in vivo

Fig 7 Effect of SSA on NK cells and monocytes/macrophages in vivo

TrendMD

References 28

[1]	YANG Y Y, TANG Y Z, FAN C L, et al. Identification and determination of the saikosaponins in Radix bupleuri by accelerated solvent extraction combined with rapid-resolution LC-MS[J]. J Sep Sci, 2010, 33(13): 1933-1945.
[2]	GAO H, SONG Y Y, LI D S, et al. Saikosaponin A inhibits IL-1β- induced inflammatory mediators in human osteoarthritis chondrocytes by activating LXRα[J]. Oncotarget, 2017, 8(51): 88941-88950.
[3]	SUN X H, CHAI Y H, BAI X T, et al. Pharmacology, medical uses, and clinical translational challenges of Saikosaponin A: a review[J]. Heliyon, 2024, 10(22): e40427.
[4]	ZHAO X, LIU J Y, GE S S, et al. Saikosaponin A inhibits breast cancer by regulating Th1/Th2 balance[J]. Front Pharmacol, 2019, 10: 624.
[5]	LU C N, YUAN Z G, ZHANG X L, et al. Saikosaponin a and its epimer saikosaponin d exhibit anti-inflammatory activity by suppressing activation of NF-κB signaling pathway[J]. Int Immunopharmacol, 2012, 14(1): 121-126.
[6]	YOUN J I, NAGARAJ S, COLLAZO M, et al. Subsets of myeloid-derived suppressor cells in tumor-bearing mice[J]. J Immunol, 2008, 181(8): 5791-5802.
[7]	WU Y Z, YI M, NIU M K, et al. Myeloid-derived suppressor cells: an emerging target for anticancer immunotherapy[J]. Mol Cancer, 2022, 21(1): 184.
[8]	SUI H S, DONGYE S Y, LIU X C, et al. Immunotherapy of targeting MDSCs in tumor microenvironment[J]. Front Immunol, 2022, 13: 990463.
[9]	WANG Y G, DING Y X, GUO N Z, et al. MDSCs: key criminals of tumor pre-metastatic niche formation[J]. Front Immunol, 2019, 10: 172.
[10]	LIU H Y, WANG Z C, ZHOU Y T, et al. MDSCs in breast cancer: an important enabler of tumor progression and an emerging therapeutic target[J]. Front Immunol, 2023, 14: 1199273.
[11]	ZHANG W Q, LUO M J, ZHOU Y X, et al. Liver X receptor agonist GW3965 protects against sepsis by promoting myeloid derived suppressor cells apoptosis in mice[J]. Life Sci, 2021, 276: 119434.
[12]	TAVAZOIE M F, POLLACK I, TANQUECO R, et al. LXR/ApoE activation restricts innate immune suppression in cancer[J]. Cell, 2018, 172(4): 825-840.e18.
[13]	LI X, LI X Y, HUANG N N, et al. A comprehensive review and perspectives on pharmacology and toxicology of saikosaponins[J]. Phytomedicine, 2018, 50: 73-87.
[14]	LIU Y, GAO L, ZHAO X Y, et al. Saikosaponin A protects from pressure overload-induced cardiac fibrosis via inhibiting fibroblast activation or endothelial cell EndMT[J]. Int J Biol Sci, 2018, 14(13): 1923-1934.
[15]	KUMAZAWA Y, KAWAKITA T, TAKIMOTO H, et al. Protective effect of saikosaponin A, saikosaponin D and saikogenin D against Pseudomonas aeruginosa infection in mice[J]. Int J Immunopharmacol, 1990, 12(5): 531-537.
[16]	PENG M Y, HUANG B Q, ZHANG Q, et al. Embelin inhibits pancreatic cancer progression by directly inducing cancer cell apoptosis and indirectly restricting IL-6 associated inflammatory and immune suppressive cells[J]. Cancer Lett, 2014, 354(2): 407-416.
[17]	SHEN J, ZHANG M Y, ZHANG K, et al. Effect of Angelica polysaccharide on mouse myeloid-derived suppressor cells[J]. Front Immunol, 2022, 13: 989230.
[18]	ZENG X Y, LUO Z X, WU J Y, et al. Cerebral ischemia-reperfusion injury: lysophosphatidic acid mediates inflammation by decreasing the expression of liver X receptor[J]. J Mol Neurosci, 2020, 70(9): 1376-1384.
[19]	CHEN Y, WANG J Y, YUAN L, et al. Interaction of the main components from the traditional Chinese drug pair Chaihu-Shaoyao based on rat intestinal absorption[J]. Molecules, 2011, 16(11): 9600-9610.
[20]	MORA-RAMIRO B, JIMÉNEZ-ESTRADA M, ZENTELLA-DEHESA A, et al. Cacalol acetate, a sesquiterpene from Psacalium decompositum, exerts an anti-inflammatory effect through LPS/NF-KB signaling in raw 264.7 macrophages[J]. J Nat Prod, 2020, 83(8): 2447-2455.
[21]	JAKOBSSON T, TREUTER E, GUSTAFSSON J Å, et al. Liver X receptor biology and pharmacology: new pathways, challenges and opportunities[J]. Trends Pharmacol Sci, 2012, 33(7): 394-404.
[22]	YU H, PARDOLL D, JOVE R. STATs in cancer inflammation and immunity: a leading role for STAT3[J]. Nat Rev Cancer, 2009, 9(11): 798-809.
[23]	BRUGER A M, VANHAVER C, BRUDEREK K, et al. Protocol to assess the suppression of T-cell proliferation by human MDSC[J]. Methods Enzymol, 2020, 632: 155-192.
[24]	DYSTHE M, PARIHAR R. Myeloid-derived suppressor cells in the tumor microenvironment[J]. Adv Exp Med Biol, 2020, 1224: 117-140.
[25]	RODRÍGUEZ P C, OCHOA A C. Arginine regulation by myeloid derived suppressor cells and tolerance in cancer: mechanisms and therapeutic perspectives[J]. Immunol Rev, 2008, 222: 180-191.
[26]	FUJIWARA K, OGIHARA Y. Pharmacological effects of oral saikosaponin a may differ depending on conditions of the gastrointestinal tract[J]. Life Sci, 1986, 39(4): 297-301.
[27]	RYAN N, ANDERSON K, VOLPEDO G, et al. STAT1 inhibits T-cell exhaustion and myeloid derived suppressor cell accumulation to promote antitumor immune responses in head and neck squamous cell carcinoma[J]. Int J Cancer, 2020, 146(6): 1717-1729.
[28]	YUE J, SU K, ZHANG G X, et al. Dihydrotanshinone attenuates LPS-induced acute lung injury in mice by upregulating LXRα[J]. Inflammation, 2022, 45(1): 212-221.